1QWA
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
History
Please read more about PDB versioning on our help page.
| Version | Date | Type | |
| 1-0 | 2003-11-25 | Initial release | No files available. |
| 1-1 | 2008-04-29 | Version format compliance | No files available. |
| 1-2 | 2011-07-13 | Version format compliance | No files available. |
| 1-3 | 2012-02-01 | Other | |
| 2-0 | 2021-04-07 | Data collection, Database references, Non-polymer description, Source and taxonomy, Structure summary | No files available. |
| 2-1 | 2024-05-01 | Data collection, Database references |
