Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help
PDBID:9xhe
Status:AUTH -- processed, waiting for author review and approval
Title:The cryo-EM structure of Congored bound type1 amyloid beta 42 fibril
Authors:Zhao, Q.Y., Cao, T.Y., Liu, C., Li, D.
Deposition date:2025-10-31
PDBID:9z08
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing separate insert strand with sequence GACGGTAATT
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-31
PDBID:9xgl
Status:AUCO -- author corrections pending review
Title:D-alanyl carrier protein
Authors:Jeon, H., Lee, I.-G.
Deposition date:2025-10-30
PDBID:9xgm
Status:REPL -- author sent new coordinates, entry to be reprocessed
Title:D-alanyl carrier protein S36A
Authors:Jeon, H., Lee, I.-G.
Deposition date:2025-10-30
PDBID:9yza
Status:AUTH -- processed, waiting for author review and approval
Title:Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzc
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzb
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzd
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzf
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzl
Status:AUTH -- processed, waiting for author review and approval
Title:Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5'' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzm
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzn
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzo
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzp
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzq
Status:AUTH -- processed, waiting for author review and approval
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yze
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzj
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzi
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzt
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9z01
Status:AUTH -- processed, waiting for author review and approval
Title:Crystal structure of a large RuBisCO from Promethearchaeum syntrophicum
Authors:Pereira, J.H., Kehl, A.J., Shih, P.M., Adams, P.D.
Deposition date:2025-10-30
PDBID:9yzu
Status:AUTH -- processed, waiting for author review and approval
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzs
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzr
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzg
Status:PROC -- to be processed
Title:Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30
PDBID:9yzk
Status:AUTH -- processed, waiting for author review and approval
Title:Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Authors:Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Deposition date:2025-10-30

245011

數據於2025-11-19公開中

PDB statisticsPDBj update infoContact PDBjnumon