| PDBID: | 9yza | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzc | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzb | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzd | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzf | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzm | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzn | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzo | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzp | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzq | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yze | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzj | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzi | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzu | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzs | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzt | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzr | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzg | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzk | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzv | | Status: | PROC -- to be processed | | Title: | Joint Xray/Neutron structure of human DJ-1 at room temperature | | Authors: | Lin, J., Kovalevsky, A., Walker, A.R., Wilson, M.A. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9xfo | | Status: | PROC -- to be processed | | Title: | BAM-SurA complex (P2-visible 1) | | Authors: | Kohga, H., Miyazaki, R., Tsukazaki, T. | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9xg4 | | Status: | PROC -- to be processed | | Title: | The crystal structure of SARS-CoV-1 Main protease in complex with inhibitor FD2-21 | | Authors: | Zhong, B.S., Luo, G., Wang, G., Lu, W.Y. | | Deposition date: | 2025-10-29 | | Release date: | 2026-10-29 |
|
| PDBID: | 9xew | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of DieK-1 bound human MLKL pseudokinase domain | | Authors: | Wang, G., Jia, K., Sun, L., Ding, J. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy7 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Histidine-covalent alpha-helical peptide (compound 6) targeting hMcl-1 | | Authors: | Muzzarelli, K.M., Assar, Z., Alboreggia, G., Udompholkul, P., Pellecchia, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yya | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Macrophage Migration Inhibitory Factor 1 from Necator Americanus | | Authors: | Orkwis, J.A., Lolis, E.J., Ramu, M. | | Deposition date: | 2025-10-28 |
|
