| PDBID: | 9yzl | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5'' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzm | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzn | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzo | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzp | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzq | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yze | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzj | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzu | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzs | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzt | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzr | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzg | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzk | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzz | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of Trastuzumab Fab conjugated to Linker-Payload | | Authors: | Jaime-Garza, M., Noland, C.L., Gabelli, S.B. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzi | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9xee | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal Structure of Beta vulgaris (Sugar beet) DJ-1D Protein | | Authors: | MacCarthy, C., Bulgakov, N., Petrova, D., Shevtsov, M.Y., Zharkov, D., Borshchevskiy, V. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9xf6 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Bacterial IgM-degrading enzyme | | Authors: | Chen, C., Zhang, K. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3m | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 11 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3q | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of D1228V c-MET bound by cabozantinib. | | Authors: | Collie, G.W., Russell, I.C. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy7 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Irreversible targeting of EphA2 with a Tyr-covalent agent | | Authors: | Baggio, C., Prentiss, A.M., Muzzarelli, K.M., Assar, Z., Pellecchia, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3g | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 12 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yxj | | Status: | HPUB -- hold until publication | | Title: | GluA2 flip-Q isoform in complex with TARP gamma2(KKEE) mutant, co-expressed without tether, TR-CEM, sprayed with agonist, (C3-m, LBD B/C) | | Authors: | Nakagawa, T., Ivica, J., Greger, I. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9xdc | | Status: | HPUB -- hold until publication | | Title: | TamAB hybrid barrel state | | Authors: | Dong, C., Zhang, Z., Yang, B. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yx3 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Duck hepatitis B virus nucleocapsid | | Authors: | Gibes, N.G., Wang, J.C.-Y., Hu, J., Zlotnick, A. | | Deposition date: | 2025-10-26 |
|
