| PDBID: | 9yzu | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzs | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzt | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzr | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzg | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzk | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzz | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of Trastuzumab Fab conjugated to Linker-Payload | | Authors: | Jaime-Garza, M., Noland, C.L., Gabelli, S.B. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9xee | | Status: | PROC -- to be processed | | Title: | Crystal Structure of Beta vulgaris (Sugar beet) DJ-1D Protein | | Authors: | MacCarthy, C., Shevtsov, M.Y., Petrova, D., Bulgakov, N., Borshchevskiy, V., Zharkov, D. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9xf6 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Bacterial IgM-degrading enzyme | | Authors: | Chen, C., Zhang, K. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3m | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 11 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3q | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of D1228V c-MET bound by cabozantinib. | | Authors: | Collie, G.W., Russell, I.C. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9xdc | | Status: | HPUB -- hold until publication | | Title: | TamAB hybrid barrel state | | Authors: | Dong, C., Zhang, Z., Yang, B. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3g | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal Structure of 12 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yxj | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | GluA2 flip-Q isoform in complex with TARP gamma2(KKEE) mutant, co-expressed without tether, TR-CEM, sprayed with agonist, (C3-m, LBD B/C) | | Authors: | Nakagawa, T., Ivica, J., Greger, I. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yx3 | | Status: | PROC -- to be processed | | Title: | Duck hepatitis B virus nucleocapsid | | Authors: | Gibes, N.G., Wang, J.C.-Y., Hu, J., Zlotnick, A. | | Deposition date: | 2025-10-26 |
|
| PDBID: | 9yx7 | | Status: | HPUB -- hold until publication | | Title: | Local refinement of BA.3.2 spike (3-RBD-down), RBD-A and NTD-C | | Authors: | Wang, Y., Hu, Y., Chen, Z., Liang, B., Xie, X. | | Deposition date: | 2025-10-26 |
|
| PDBID: | 9yx8 | | Status: | HPUB -- hold until publication | | Title: | Local refinement of BA.3.2 spike (3-RBD-down), RBD-A, RBD-C and NTD-B | | Authors: | Wang, Y., Hu, Y., Chen, Z., Liang, B., Xie, X. | | Deposition date: | 2025-10-26 |
|
| PDBID: | 9yx9 | | Status: | PROC -- to be processed | | Title: | SARS-CoV-2 SL5 rotated junction | | Authors: | Kretsch, R.C., Xu, L., Chiu, W., Das, R. | | Deposition date: | 2025-10-26 |
|
| PDBID: | 9yxa | | Status: | PROC -- to be processed | | Title: | BtCoV SL5 with SL5c truncated | | Authors: | Kretsch, R.C., Xu, L., Chiu, W., Das, R. | | Deposition date: | 2025-10-26 |
|
| PDBID: | 9xbj | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of Arabidopsis KJC2 in dodecamer state | | Authors: | Zhang, C., Chen, X., Liu, L. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9xbh | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of E19A mutant chitosanase from Bacillus subtilis MY002 complexed with GlcNs. | | Authors: | Xie, J., Liu, Z.C., Wang, G.G. | | Deposition date: | 2025-10-24 | | Release date: | 2026-10-24 |
|
| PDBID: | 9xc3 | | Status: | PROC -- to be processed | | Title: | complex of TCR1414_1-TGFbetaR2(-1)-HLA-DR4, a TGFbetaR2(-1)-HLA-DR4,with a TGFbetaR2(-1) specific TCRl414_1 | | Authors: | Shi, J.L., Wu, D.C. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9t2x | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Structure of protein kinase CK2 catalytic subunit CK2alpha'' (CSNK2A2 gene product) in complex with the indenoindole-precursor compound JC0151 | | Authors: | Werner, C., Jose, J., Le Borgne, M., Niefind, K. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9ywg | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Structure of mouse TRPV3 (412S), heated to 42 C by DSC | | Authors: | Mugo, A.N., Qin, F. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9t2z | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Spindlin 1 with crystallization epitope mutations H127D:L128D:T131R | | Authors: | Fairhead, M., Strain-Damerell, C., Ye, M., Mackinnon, S.R., Pinkas, D., MacLean, E.M., Koekemoer, L., Bowesman-Jones, H., Damerell, D., Krojer, T., Arrowsmith, C.H., Edwards, A., Bountra, C., Yue, W., Burgess-Brown, N., Marsden, B., von Delft, F. | | Deposition date: | 2025-10-24 |
|
