| PDBID: | 9m32 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | The Cryo-EM structure of MPXV E5 in complex with ssDNA | | Authors: | Xing, X., Wang, X. | | Deposition date: | 2025-02-28 |
|
| PDBID: | 9m33 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-28 |
|
| PDBID: | 9m35 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-28 |
|
| PDBID: | 9m34 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-28 |
|
| PDBID: | 9njp | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njb | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njc | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njs | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9nje | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njq | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njd | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njl | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9nj9 | | Status: | HPUB -- hold until publication | | Title: | Computationally optimized broadly reactive influenza B hemagglutinin BC2 bound by antibodies #46 and #3978 | | Authors: | Dzimianski, J.V., Kunkel, I., Balasco Serrao, V.H., DuBois, R.M. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9nja | | Status: | HPUB -- hold until publication | | Title: | Computationally optimized broadly reactive influenza B hemagglutinin BC2 bound by antibody #46 | | Authors: | Dzimianski, J.V., Kunkel, I., Balasco Serrao, V.H., DuBois, R.M. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njg | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njn | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njm | | Status: | HPUB -- hold until publication | | Title: | hMCT1-BSGiso2-INX444 | | Authors: | Lo, Y.-H., Dorsey, F.C. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa7 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9x | | Status: | HPUB -- hold until publication | | Title: | Redesigned nitrobindin to bind fluorescent ligand | | Authors: | Lechner, H., Oberdorfer, G. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa9 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9w | | Status: | HPUB -- hold until publication | | Title: | Redesigned nitrobindin to bind fluorescent ligand - | | Authors: | Lechner, H., Oberdorfer, G. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa5 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa8 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9y | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 | | Sequence: | >Entity 1
MAVAVDLGNRKLEISSGKLARFADGSAVVQSGDTAVMVTAVSKTKPSPSQFMPLVVDYRQKAAAAGRIPTNYLRREIGTSDKEILTSRIIDRSIRPLFPAGYFYDTQVLCNLLAVDGVNEPDVLAINGASVALSLSDIPWNGPVGAVRIGIIDGEYVVNPTRKEMSSSTLNLVVAGAPKSQIVMLEASAENILQQDFCHAIKVGVKYTQQIIQGIQQLVKETGVTKRTPQKLFTPSPEIVKYTHKLAMERLYAVFTDYEHDKVSRDEAVNKIRLDTEEQLKEKFPEADPYEIIESFNVVAKEVFRSIVLNEYKRCDGRDLTSLRNVSCEVDMFKTLHGSALFQRGQTQVLCTVTFDSLESGIKSDQVITAINGIKDKNFMLHYEFPPYATNEIGKVTGLNRRELGHGALAEKALYPVIPRDFPFTIRVTSEVLESNGSSSMASACGGSLALMDSGVPISSAVAGVAIGLVTKTDPEKGEIEDYRLLTDILGIEDYNGDMDFKIAGTNKGITALQADIKLPGIPIKIVMEAIQQASVAKKEILQIMNKTISKPRASRKENGPVVETVQVPLSKRAKFVGPGGYNLKKLQAETGVTISQVDEETFSVFAPTPSAMHEARDFITEICKDDQEQQLEFGAVYTATITEIRDTGVMVKLYPNMTAVLLHNTQLDQRKIKHPTALGLEVGQEIQVKYFGRDPADGRMRLSRKVLQSPATTVVRTLNDRSSIVMGEPISQSSSNSQSGSGSAWSHPQFEKGGGSGGGSGGSAWSHPQFEK
>Entity 2
ACACAACACAACACACACCACACACACAUAAAACAAAACA
|
|
| PDBID: | 9q9z | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
