| PDBID: | 9gxa | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | CENP-A/H4 di-tetrasome assembled on alpha-satellite DNA. | | Authors: | Ali-Ahmad, A., Sekulic, N. | | Deposition date: | 2024-09-29 |
|
| PDBID: | 9guo | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Human carbonic anhydrase II complexed with 2-(1H-tetrazol-5-yl)acetic acid | | Authors: | Angeli, A., Ferraroni, M. | | Deposition date: | 2024-09-20 |
|
| PDBID: | 9gu7 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Human carbonic anhydrase II complexed with N-phenyl-2-(1H-tetrazol-5-yl)acetamide | | Authors: | Angeli, A., Ferraroni, M. | | Deposition date: | 2024-09-19 |
|
| PDBID: | 9gum | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Human carbonic anhydrase II complexed with N-phenethyl-2-(1H-tetrazol-5-yl)acetamide | | Authors: | Angeli, A., Ferraroni, M. | | Deposition date: | 2024-09-19 |
|
| PDBID: | 9dn8 | | Status: | PROC -- to be processed | | Title: | RamR variant S2.3 complexed with 1S-1-phenyl-1,2,3,4-tetrahydroisoquinoline | | Authors: | Kim, W., Zhang, Y.J. | | Deposition date: | 2024-09-17 |
|
| PDBID: | 9dn9 | | Status: | PROC -- to be processed | | Title: | RamR variant S2.4 complexed with 1S-1-phenyl-1,2,3,4-tetrahydroisoquinoline | | Authors: | Kim, W., Zhang, Y.J. | | Deposition date: | 2024-09-17 |
|
| PDBID: | 9dnk | | Status: | PROC -- to be processed | | Title: | RamR variant R2.1 complexed with 1R-1-phenyl-1,2,3,4-tetrahydroisoquinoline. | | Authors: | Kim, W., Zhang, Y.J. | | Deposition date: | 2024-09-17 |
|
| PDBID: | 9gqs | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Teth514_1788 1,2-beta-oligomannan phosphorylase in complex with mannose (+1) and phosphate | | Authors: | Cioci, G., Durand, J., Veronese-Potocki, G., Ladeveze, S. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gph | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Teth514_1788 1,2-beta-oligomannan phosphorylase in complex with mannose (-1) and phosphate | | Authors: | Cioci, G., Durand, J., Veronese-Potocki, G., Ladeveze, S. | | Deposition date: | 2024-09-07 |
|
| PDBID: | 9jen | | Status: | HPUB -- hold until publication | | Title: | Chito oligosaccharide deacetylase from vibrio campbellii (VhCOD) complex Tetraacetyl-Chitotetraose Oligosaccharide (GlcNAc)4 | | Authors: | Sirikan, P., Tamo, F., Robinson, R.C., Wipa, S. | | Deposition date: | 2024-09-03 |
|
| PDBID: | 9dhb | | Status: | HPUB -- hold until publication | | Title: | STRUCTURE OF SERINE HYDROXYMETHYLTRANSFERASE 5 FROM GLYCINE MAX CULTIVAR ESSEX COMPLEXED WITH PLP-GLYCINE AND 5-FORMYLTETRAHYDROFOLATE | | Authors: | Beamer, L.J., Owuocha, L.F. | | Deposition date: | 2024-09-03 |
|
| PDBID: | 9jc8 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Tetrahymena Ribozyme L-16 inhibited state | | Authors: | Pan, Z.L., Hu, H., Su, Z.M. | | Deposition date: | 2024-08-29 | | Release date: | 2025-08-29 |
|
| PDBID: | 9de4 | | Status: | HPUB -- hold until publication | | Title: | Er-Bound Structure of Computationally Designed Homotetramer PW1 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-28 |
|
| PDBID: | 9glq | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of p73 tetramerisation domain in complex with darpins 1800 | | Authors: | Chaikuad, A., Strubel, A., Doetsch, V., Knapp, S., Structural Genomics Consortium (SGC) | | Deposition date: | 2024-08-27 |
|
| PDBID: | 9j9x | | Status: | HOLD -- hold until a certain date | | Title: | Tetrahymena Ribozyme L-16 complex with small molecule inhibitor ZP-Tth70 | | Authors: | Pan, Z.L., Hu, H., Su, Z.M. | | Deposition date: | 2024-08-23 | | Release date: | 2025-08-23 | | Sequence: | >Entity 1
GAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUGAAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAG
|
|
| PDBID: | 9db8 | | Status: | HPUB -- hold until publication | | Title: | Cu-Bound Structure of Computationally Designed Homotrimer Tet4 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9db9 | | Status: | HPUB -- hold until publication | | Title: | Ni-Bound Structure of Computationally Designed Homotrimer Tet4 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dba | | Status: | HPUB -- hold until publication | | Title: | Co-Bound Structure of Computationally Designed Homotrimer Tet4 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbb | | Status: | HPUB -- hold until publication | | Title: | Fe-Bound Structure of Computationally Designed Homotrimer Tet4 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbc | | Status: | HPUB -- hold until publication | | Title: | Mn-Bound Structure of Computationally Designed Homotrimer Tet4 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbd | | Status: | HPUB -- hold until publication | | Title: | Zn-Bound Structure of a Single-Chain Tet4 Variant with an H38E Mutation | | Authors: | Hoffnagle, A.M., Neeley, M.N., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbf | | Status: | HPUB -- hold until publication | | Title: | Zn-Bound Structure of a Single-Chain Tet4 Variant with an L42W Mutation | | Authors: | Hoffnagle, A.M., Neeley, M.N., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbu | | Status: | HPUB -- hold until publication | | Title: | Apo Structure of Computationally Designed Homotetramer PW1 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbv | | Status: | HPUB -- hold until publication | | Title: | Cu-Bound Structure of Computationally Designed Homotetramer PW1 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
| PDBID: | 9dbw | | Status: | HPUB -- hold until publication | | Title: | Rh-Bound Structure of Computationally Designed Homotetramer PW1 | | Authors: | Hoffnagle, A.M., Tezcan, F.A. | | Deposition date: | 2024-08-23 |
|
