| PDBID: | 9w8x | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w8y | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Structure of yeast Pol II complexed with a longer scaffold containing a cisplatin-induced inter-strand crosslink at the + 3 position. | | Authors: | Xu, J., Zhu, L. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w8z | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Structure of yeast Pol II complexed with a longer scaffold containing a cisplatin-induced inter-strand crosslink at the + 2 position. | | Authors: | Xu, J., Zhu, L. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w8v | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w8u | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w94 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w93 | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of a novel amidase variant with complex from Sphingomonas sp | | Authors: | Li, W.S., Chen, Y.Y., Zhang, S.Y., Li, Z.S., Han, X., Liu, W.D. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w90 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w91 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9w92 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz4 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of 2-methoxyhydroquinone dioxygenase (MhdA) from Gelatoporia subvermispora | | Authors: | Mathews, I.I., Kuatsjah, E., Schwartz, A., Sarangi, R., McGeehan, J.E., Salvachua, D. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz0 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | SARS-CoV-2 core polymerase complex with two UTP incorporation | | Authors: | Xiao, Z., Kirchdeorfer, R.N. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyz | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | SARS-CoV-2 core polymerase complex bound to RNA, araUMP, and UTP | | Authors: | Xiao, Z., Kirchdeorfer, R.N. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyr | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz7 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA | | Authors: | Werther, R., Stoddard, B.L. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyt | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | NMR RDC refinement of the catalytic domain of the SARS-CoV-2 monomeric Main Protease (MPROH41Q,10-306) | | Authors: | Smith, M.J., Ying, J., Shen, Y., Louis, J.M., Bax, A. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pys | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | NMR RDC refinement of the helical domain of the SARS-CoV-2 monomeric Main Protease (MPROH41Q,10-306) | | Authors: | Smith, M.J., Ying, J., Shen, Y., Louis, J.M., Bax, A. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyu | | Status: | PROC -- to be processed | | Title: | E. Coli Glucokinase - K216Q | | Authors: | Andrews, J.R.W., Fan, C., Sakon, J. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz9 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | DNA ligase 1 E346A/E592A in complex with nick containing 3''-8oxorG:A captured at post-catalytic stage | | Authors: | KanalElamparithi, B., Caglayan, M. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pza | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | DNA ligase 1 E346A/E592A in complex with nick containing 3''-8oxorG:C captured at pre-catalytic stage | | Authors: | KanalElamparithi, B., Caglayan, M. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyo | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of Fe/2-OG dependent dioxygenase MysH in complex with iron and 2-oxoglutarate | | Authors: | Wanniarachchi, T.N., Bruner, S.D. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz8 | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of the glutathionylated, 26 kDa, glutathione transferase from Taenia solium | | Authors: | Hernandez-Santoyo, A., Rodriguez-Romero, A. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyp | | Status: | PROC -- to be processed | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pyq | | Status: | PROC -- to be processed | | Title: | Mercaptosuccinate dioxygenase in complex with 2-sulfinosuccinate, a dioxygenated product of R-mercaptosuccinate | | Authors: | Jordan, S., Ralls, H., Wang, Y. | | Deposition date: | 2025-08-08 |
|
| PDBID: | 9pz5 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Native anti-NANP Fab | | Authors: | Young, T. | | Deposition date: | 2025-08-08 |
|
