| PDBID: | 9njn | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9njm | | Status: | HPUB -- hold until publication | | Title: | hMCT1-BSGiso2-INX444 | | Authors: | Lo, Y.-H., Dorsey, F.C. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa7 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9x | | Status: | HPUB -- hold until publication | | Title: | Redesigned nitrobindin to bind fluorescent ligand | | Authors: | Lechner, H., Oberdorfer, G. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa9 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9w | | Status: | HPUB -- hold until publication | | Title: | Redesigned nitrobindin to bind fluorescent ligand - | | Authors: | Lechner, H., Oberdorfer, G. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa5 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa8 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9y | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 | | Sequence: | >Entity 1
MAVAVDLGNRKLEISSGKLARFADGSAVVQSGDTAVMVTAVSKTKPSPSQFMPLVVDYRQKAAAAGRIPTNYLRREIGTSDKEILTSRIIDRSIRPLFPAGYFYDTQVLCNLLAVDGVNEPDVLAINGASVALSLSDIPWNGPVGAVRIGIIDGEYVVNPTRKEMSSSTLNLVVAGAPKSQIVMLEASAENILQQDFCHAIKVGVKYTQQIIQGIQQLVKETGVTKRTPQKLFTPSPEIVKYTHKLAMERLYAVFTDYEHDKVSRDEAVNKIRLDTEEQLKEKFPEADPYEIIESFNVVAKEVFRSIVLNEYKRCDGRDLTSLRNVSCEVDMFKTLHGSALFQRGQTQVLCTVTFDSLESGIKSDQVITAINGIKDKNFMLHYEFPPYATNEIGKVTGLNRRELGHGALAEKALYPVIPRDFPFTIRVTSEVLESNGSSSMASACGGSLALMDSGVPISSAVAGVAIGLVTKTDPEKGEIEDYRLLTDILGIEDYNGDMDFKIAGTNKGITALQADIKLPGIPIKIVMEAIQQASVAKKEILQIMNKTISKPRASRKENGPVVETVQVPLSKRAKFVGPGGYNLKKLQAETGVTISQVDEETFSVFAPTPSAMHEARDFITEICKDDQEQQLEFGAVYTATITEIRDTGVMVKLYPNMTAVLLHNTQLDQRKIKHPTALGLEVGQEIQVKYFGRDPADGRMRLSRKVLQSPATTVVRTLNDRSSIVMGEPISQSSSNSQSGSGSAWSHPQFEKGGGSGGGSGGSAWSHPQFEK
>Entity 2
ACACAACACAACACACACCACACACACAUAAAACAAAACA
|
|
| PDBID: | 9q9z | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qaa | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of Borrelia burgdorferi BB0238-BB0323 complex (BB0238 residues 118-256; BB0323 residues 26-210) | | Authors: | Brangulis, K. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2l | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of okaE in complex with a-ketoglutarate and okaramine A at 2.5 angstroms resolution. | | Authors: | Liu, T.H., Yan, W.P. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m25 | | Status: | HOLD -- hold until a certain date | | Title: | Type I diterpene synthase from Streptomyces | | Authors: | Bai, Z.Y., Ma, M. | | Deposition date: | 2025-02-27 | | Release date: | 2026-02-27 |
|
| PDBID: | 9m2c | | Status: | HPUB -- hold until publication | | Title: | Type I PQQ-dependent alcohol dehydrogenase | | Authors: | Shi, Y., Mu, W.M., Xu, W. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2j | | Status: | HPUB -- hold until publication | | Title: | Type I PQQ-dependent alcohol dehydrogenase | | Authors: | Shi, Y., Xu, W., Mu, W.M. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2k | | Status: | HPUB -- hold until publication | | Title: | Type I PQQ-dependent alcohol dehydrogenase | | Authors: | Shi, Y., Mu, W.M., Xu, W. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2b | | Status: | HPUB -- hold until publication | | Title: | X-ray structure of human heart fatty acid-binding protein (apo-FABP3) | | Authors: | Sugiyama, S., Maekawa, S., Matsuoka, S., Murata, M. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m23 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m28 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2a | | Status: | HPUB -- hold until publication | | Title: | The crystal structure of the trypanosome alternative oxidase complexed with a trypanocidal phosphonium derivative (compound1) | | Authors: | Ebiloma, G.U., Balogun, E.O., Dardonville, C., De Koning, H.P., Shiba, T. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2e | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of Nur77 LBD in complex with DBIC compound | | Authors: | Hong, W.B., Lin, T.W., Chen, X.Q., Wu, Q. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2i | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9m2n | | Status: | HOLD -- hold until a certain date | | Deposition date: | 2025-02-27 | | Release date: | 2026-02-27 |
|
| PDBID: | 9m2g | | Status: | HOLD -- hold until a certain date | | Deposition date: | 2025-02-27 | | Release date: | 2026-02-27 |
|
| PDBID: | 9m2m | | Status: | HPUB -- hold until publication | | Title: | the crystal structure of okaE | | Authors: | Liu, T.H., Yan, W.P., Wang, X.Y. | | Deposition date: | 2025-02-27 |
|
