PDBID: | 9j9q | Status: | HOLD -- hold until a certain date | Title: | artificial mononuclear Cu-bound metalloprotein 6 (M6:Cu) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9j9r | Status: | HOLD -- hold until a certain date | Title: | artificial mononuclear Zn-bound metalloprotein 6 (M6:Zn) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9j9x | Status: | HOLD -- hold until a certain date | Title: | Tetrahymena Ribozyme L-16 complex with small molecule inhibitor ZP-Tth70 | Authors: | Pan, Z.L., Hu, H., Su, Z.M. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 | Sequence: | >Entity 1 GAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUGAAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAG
|
|
PDBID: | 9j9s | Status: | HOLD -- hold until a certain date | Title: | artificial mononuclear Zn-bound metalloprotein 5 (M5:Zn) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9j9t | Status: | HOLD -- hold until a certain date | Title: | artificial mononuclear Zn-bound metalloprotein 4 (M4:Zn) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9j9u | Status: | AUTH -- processed, waiting for author review and approval | Title: | artificial dinuclear Mn-bound metalloprotein 2 (D2:Mn) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9ja2 | Status: | AUTH -- processed, waiting for author review and approval | Deposition date: | 2024-08-23 |
|
PDBID: | 9j9v | Status: | HOLD -- hold until a certain date | Title: | artificial dinuclear Fe-bound metalloprotein 2 (D2:Fe) | Authors: | Jeong, W.J., Song, W.J. | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9j9z | Status: | REPL -- author sent new coordinates, entry to be reprocessed | Title: | Cryo-EM structure of Outward state Anhydromuropeptide permease (AmpG) complex with GlcNAc-1,6-anhMurNAc | Authors: | Chang, N., Kim, U., Cho, H. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db6 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Sialidase682 co-crystallized with inhibitor DANA | Authors: | Young, M.A., Rees, S.D., Chang, G. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db8 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Cu-Bound Structure of Computationally Designed Homotrimer Tet4 | Authors: | Hoffnagle, A.M., Tezcan, F.A. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db5 | Status: | AUTH -- processed, waiting for author review and approval | Title: | A DARPin fused to the 1TEL crystallization chaperone via a proline-alanine linker | Authors: | Pedroza Romo, M.J., Averett, J.C., Keliiliki, A., Wilson, E.W., Smith, C., Hansen, D., Averett, B., Gonzalez, J., Noakes, E., Nickles, R., Doukov, T., Moody, J.D. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db9 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Ni-Bound Structure of Computationally Designed Homotrimer Tet4 | Authors: | Hoffnagle, A.M., Tezcan, F.A. | Deposition date: | 2024-08-23 |
|
PDBID: | 9dba | Status: | AUTH -- processed, waiting for author review and approval | Title: | Co-Bound Structure of Computationally Designed Homotrimer Tet4 | Authors: | Hoffnagle, A.M., Tezcan, F.A. | Deposition date: | 2024-08-23 |
|
PDBID: | 9dbb | Status: | AUTH -- processed, waiting for author review and approval | Title: | Fe-Bound Structure of Computationally Designed Homotrimer Tet4 | Authors: | Hoffnagle, A.M., Tezcan, F.A. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db2 | Status: | HPUB -- hold until publication | Deposition date: | 2024-08-23 |
|
PDBID: | 9daz | Status: | AUTH -- processed, waiting for author review and approval | Title: | Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. Complex of fAPN with FCoV-23 RBD | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | Deposition date: | 2024-08-23 |
|
PDBID: | 9db0 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S short | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | Deposition date: | 2024-08-23 |
|
PDBID: | 9db1 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S Do in proximal conformation (local refinement) | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | Deposition date: | 2024-08-23 |
|
PDBID: | 9db3 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S long with Do in swung-out conformation | Authors: | Tortorici, M.A., Veesler, D. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db7 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Crystal structure of NDM-1 complexed with compound 21 | Authors: | Jacobs, L.M.C., Chen, Y. | Deposition date: | 2024-08-23 |
|
PDBID: | 9db4 | Status: | AUTH -- processed, waiting for author review and approval | Title: | Binary complex of DNA polymerase iota with DNA (template A) | Authors: | Frevert, Z., Reusch, D., Freudenthal, B. | Deposition date: | 2024-08-23 |
|
PDBID: | 9dbo | Status: | AUTH -- processed, waiting for author review and approval | Deposition date: | 2024-08-23 | Release date: | 2025-08-23 |
|
PDBID: | 9dbr | Status: | HPUB -- hold until publication | Deposition date: | 2024-08-23 |
|
PDBID: | 9gjq | Status: | HPUB -- hold until publication | Title: | Crystal structure of humanised cereblon from Magnetospirillum gryphiswaldense bound by dihydrouracil-indole compound [1-(1H-indol-6-yl)dihydro-2,4(1H,3H)-pyrimidinedione]. | Authors: | Collie, G.W. | Deposition date: | 2024-08-22 |
|