| PDBID: | 9qa9 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9w | | Status: | HPUB -- hold until publication | | Title: | Redesigned nitrobindin to bind fluorescent ligand - | | Authors: | Lechner, H., Oberdorfer, G. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa0 | | Status: | HPUB -- hold until publication | | Title: | Drosophila melanogaster angiotensin converting enzyme homologue, AnCE in complex with IW dipeptide | | Authors: | Zukowska, J., Gregory, K.S., Acharya, K.R. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa1 | | Status: | HPUB -- hold until publication | | Title: | Drosophila melanogaster angiotensin converting enzyme homologue, AnCE in complex with VW dipeptide | | Authors: | Zukowska, J., Gregory, K.S., Acharya, K.R. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa2 | | Status: | HPUB -- hold until publication | | Title: | Drosophila melanogaster angiotensin converting enzyme homologue, AnCE in complex with RW dipeptide | | Authors: | Zukowska, J., Gregory, K.S., Acharya, K.R. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa3 | | Status: | HPUB -- hold until publication | | Title: | Drosophila melanogaster angiotensin converting enzyme homologue, AnCE in complex with YW dipeptide | | Authors: | Zukowska, J., Gregory, K.S., Acharya, K.R. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa4 | | Status: | HPUB -- hold until publication | | Title: | Drosophila melanogaster angiotensin converting enzyme homologue, AnCE in complex with WR dipeptide | | Authors: | Zukowska, J., Gregory, K.S., Acharya, K.R. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa8 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9y | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 | | Sequence: | >Entity 1
MAVAVDLGNRKLEISSGKLARFADGSAVVQSGDTAVMVTAVSKTKPSPSQFMPLVVDYRQKAAAAGRIPTNYLRREIGTSDKEILTSRIIDRSIRPLFPAGYFYDTQVLCNLLAVDGVNEPDVLAINGASVALSLSDIPWNGPVGAVRIGIIDGEYVVNPTRKEMSSSTLNLVVAGAPKSQIVMLEASAENILQQDFCHAIKVGVKYTQQIIQGIQQLVKETGVTKRTPQKLFTPSPEIVKYTHKLAMERLYAVFTDYEHDKVSRDEAVNKIRLDTEEQLKEKFPEADPYEIIESFNVVAKEVFRSIVLNEYKRCDGRDLTSLRNVSCEVDMFKTLHGSALFQRGQTQVLCTVTFDSLESGIKSDQVITAINGIKDKNFMLHYEFPPYATNEIGKVTGLNRRELGHGALAEKALYPVIPRDFPFTIRVTSEVLESNGSSSMASACGGSLALMDSGVPISSAVAGVAIGLVTKTDPEKGEIEDYRLLTDILGIEDYNGDMDFKIAGTNKGITALQADIKLPGIPIKIVMEAIQQASVAKKEILQIMNKTISKPRASRKENGPVVETVQVPLSKRAKFVGPGGYNLKKLQAETGVTISQVDEETFSVFAPTPSAMHEARDFITEICKDDQEQQLEFGAVYTATITEIRDTGVMVKLYPNMTAVLLHNTQLDQRKIKHPTALGLEVGQEIQVKYFGRDPADGRMRLSRKVLQSPATTVVRTLNDRSSIVMGEPISQSSSNSQSGSGSAWSHPQFEKGGGSGGGSGGSAWSHPQFEK
>Entity 2
ACACAACACAACACACACCACACACACAUAAAACAAAACA
|
|
| PDBID: | 9q9z | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qa6 | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9qaa | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of Borrelia burgdorferi BB0238-BB0323 complex (BB0238 residues 118-256; BB0323 residues 26-210) | | Authors: | Brangulis, K. | | Deposition date: | 2025-02-27 |
|
| PDBID: | 9q9f | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9q9h | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9q9q | | Status: | HOLD -- hold until a certain date | | Deposition date: | 2025-02-26 | | Release date: | 2026-02-26 |
|
| PDBID: | 9q9u | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9q9a | | Status: | HPUB -- hold until publication | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9q9d | | Status: | HPUB -- hold until publication | | Title: | CK2, catalytic subunit alpha'' (CSNK2A2 gene product) in complex with F2X-Entry screen fragment D04 and CX-4945 (Silmitasertib) | | Authors: | Werner, C., Harasimowicz, H., Barthel, T., Weiss, M.S., Niefind, K. | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m1h | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m1k | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of the TBC-DE-Arl2-beta-tubulin complex with GTP | | Authors: | Seong, Y.J., Kim, H.M., Byun, K.M., Park, Y.W., Roh, S.H. | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m1l | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of the TBC-DE-Arl2-alpha-beta-tubulin complex with GTP | | Authors: | Seong, Y.J., Kim, H.M., Byun, K.M., Park, Y.W., Roh, S.H. | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m1u | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m20 | | Status: | HPUB -- hold until publication | | Title: | GmMAN19-1 from Glycine max | | Authors: | Lin, C.J., Hsu, C.H. | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m21 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | GmMAN19-1 from Glycine max in complex with mannopentaose | | Authors: | Lin, C.J., Hsu, C.H. | | Deposition date: | 2025-02-26 |
|
| PDBID: | 9m1m | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of the TBC-DEC-Arl2-alpha-beta-tubulin complex with GDP-AlFx | | Authors: | Seong, Y.J., Kim, H.M., Byun, K.M., Park, Y.W., Roh, S.H. | | Deposition date: | 2025-02-26 |
|
