PDB: 45953 resultsInfo pagesStatus searchChemie searchBIRD

---

4NCK	Crystal Structure of Pyrococcus furiosis Rad50 R797G mutation Descriptor: CHLORIDE ION, DNA double-strand break repair Rad50 ATPase, MAGNESIUM ION, ... Authors: Classen, S, Williams, G.J, Arvai, A.S, Williams, R.S. Deposit date: 2013-10-24 Release date: 2014-03-05 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.99 Å) Cite: ATP-driven Rad50 conformations regulate DNA tethering, end resection, and ATM checkpoint signaling. Embo J., 33, 2014
1P54	Effect of Sequence on the Conformational Geometry of DNA Holliday Junctions Descriptor: 5'-D(*CP*CP*AP*GP*TP*AP*CP*(BRU)P*GP*G)-3', CALCIUM ION, SODIUM ION Authors: Hays, F.A, Vargason, J.M, Ho, P.S. Deposit date: 2003-04-25 Release date: 2003-09-02 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Effect of Sequence on the Conformation of DNA Holliday Junctions Biochemistry, 42, 2003
3PFI	2.7 Angstrom resolution crystal structure of a probable holliday junction DNA helicase (ruvB) from Campylobacter jejuni subsp. jejuni NCTC 11168 in complex with adenosine-5'-diphosphate Descriptor: ADENOSINE-5'-DIPHOSPHATE, Holliday junction ATP-dependent DNA helicase ruvB Authors: Halavaty, A.S, Wawrzak, Z, Skarina, T, Onopriyenko, O, Edwards, A, Savchenko, A, Anderson, W.F, Center for Structural Genomics of Infectious Diseases (CSGID) Deposit date: 2010-10-28 Release date: 2010-11-10 Last modified: 2017-11-08 Method: X-RAY DIFFRACTION (2.695 Å) Cite: 2.7 Angstrom resolution crystal structure of a probable holliday junction DNA helicase (ruvB) from Campylobacter jejuni subsp. jejuni NCTC 11168 in complex with adenosine-5'-diphosphate To be Published
1D9X	CRYSTAL STRUCTURE OF THE DNA REPAIR PROTEIN UVRB Descriptor: EXCINUCLEASE UVRABC COMPONENT UVRB, ZINC ION Authors: Theis, K, Chen, P.J, Skorvaga, M, Van Houten, B, Kisker, C. Deposit date: 1999-10-30 Release date: 2000-05-03 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Crystal structure of UvrB, a DNA helicase adapted for nucleotide excision repair. EMBO J., 18, 1999
1IM4	Crystal Structure of a DinB Homolog (DBH) Lesion Bypass DNA Polymerase Catalytic Fragment from Sulfolobus solfataricus Descriptor: DBH, SULFATE ION Authors: Pata, J.D, Zhou, B.L, Steitz, T.A. Deposit date: 2001-05-09 Release date: 2001-09-12 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Crystal structure of a DinB lesion bypass DNA polymerase catalytic fragment reveals a classic polymerase catalytic domain. Mol.Cell, 8, 2001
1S9O	Solution structure of the nitrous acid induced DNA interstrand cross-linked dodecamer duplex CGCTAC(G)TAGCG with the cross-linked guanines denoted (G) Descriptor: 5'-D(*CP*GP*CP*TP*AP*CP*GP*TP*AP*GP*CP*G)-3' Authors: Edfeldt, N.B, Harwood, E.A, Sigurdsson, S.T, Hopkins, P.B, Reid, B.R. Deposit date: 2004-02-05 Release date: 2005-11-01 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of a nitrous acid induced DNA interstrand cross-link. Nucleic Acids Res., 32, 2004
1OLD	NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES Descriptor: ARGININEAMIDE, DNA (GATCGAAACGTAGCGCCTTCGATC) Authors: Lin, C.H, Patel, D.J. Deposit date: 1996-10-31 Release date: 1997-04-21 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Encapsulating an amino acid in a DNA fold. Nat.Struct.Biol., 3, 1996
4D9Y	The crystal structure of Chelerythrine bound to DNA d(CGTACG) Descriptor: 1,2-dimethoxy-12-methyl[1,3]benzodioxolo[5,6-c]phenanthridin-12-ium, CALCIUM ION, DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') Authors: Ferraroni, M, Bazzicalupi, C, Gratteri, P, Bilia, A.R. Deposit date: 2012-01-12 Release date: 2013-01-23 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (2.1 Å) Cite: The crystal structure of Chelerythrine bound to DNA d(CGTACG) To be Published
8JFU	AcrIIA15 in complex with palindromic DNA substrate Descriptor: AcrIIA15, DNA (5'-D(*AP*TP*TP*AP*TP*GP*AP*CP*AP*AP*AP*TP*GP*TP*CP*AP*TP*AP*G)-3'), DNA (5'-D(*TP*CP*TP*AP*TP*GP*AP*CP*AP*TP*TP*TP*GP*TP*CP*AP*TP*AP*A)-3') Authors: Deng, X, Wang, Y. Deposit date: 2023-05-18 Release date: 2024-02-28 Method: X-RAY DIFFRACTION (3.15 Å) Cite: AcrIIA15 in complex with palindromic DNA substrate To Be Published
1L8D	Rad50 coiled-coil Zn hook Descriptor: CITRIC ACID, DNA double-strand break repair rad50 ATPase, MERCURY (II) ION, ... Authors: Hopfner, K.P, Tainer, J.A. Deposit date: 2002-03-20 Release date: 2002-08-28 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2.2 Å) Cite: The Rad50 zinc-hook is a structure joining Mre11 complexes in DNA recombination and repair. Nature, 418, 2002
1OCI	[3.2.0]bcANA:DNA Descriptor: 5'-D(*CP*TP*GP*A TLBP*AP*TP*GP*CP)-3', 5'-D(*GP*CP*AP*TP*AP*TP*CP*AP*GP)-3' Authors: Tommerholt, H.V, Christensen, N.K, Nielsen, P, Wengel, J, Stein, P.C, Jacobsen, J.P, Petersen, M. Deposit date: 2003-02-07 Release date: 2003-07-14 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: NMR Solution Structure of a DsDNA Containing a Bicyclic D-Arabino-Configured Nucleotide Fixed in an O4'-Endo Sugar Conformation Org.Biomol.Chem., 1, 2003
1AJ6	NOVOBIOCIN-RESISTANT MUTANT (R136H) OF THE N-TERMINAL 24 KDA FRAGMENT OF DNA GYRASE B COMPLEXED WITH NOVOBIOCIN AT 2.3 ANGSTROMS RESOLUTION Descriptor: GYRASE, NOVOBIOCIN Authors: Weston, S.A, Tunnicliffe, A, Pauptit, R.A. Deposit date: 1997-05-15 Release date: 1998-05-20 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (2.3 Å) Cite: The entropic penalty of ordered water accounts for weaker binding of the antibiotic novobiocin to a resistant mutant of DNA gyrase: a thermodynamic and crystallographic study. Biochemistry, 36, 1997
1RES	DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION Descriptor: GAMMA DELTA-RESOLVASE Authors: Mullen, G.P. Deposit date: 1994-06-29 Release date: 1994-11-30 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Determination of the structure of the DNA binding domain of gamma delta resolvase in solution. Protein Sci., 3, 1994
1RET	DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION Descriptor: GAMMA DELTA-RESOLVASE Authors: Mullen, G.P. Deposit date: 1994-06-29 Release date: 1994-11-30 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Determination of the structure of the DNA binding domain of gamma delta resolvase in solution. Protein Sci., 3, 1994
3UOT	Crystal Structure of MDC1 FHA Domain in Complex with a Phosphorylated Peptide from the MDC1 N-terminus Descriptor: Mediator of DNA damage checkpoint protein 1 Authors: Clapperton, J.A, Lloyd, J, Haire, L.F, Li, J, Smerdon, S.J. Deposit date: 2011-11-17 Release date: 2011-12-28 Last modified: 2012-07-18 Method: X-RAY DIFFRACTION (1.8 Å) Cite: The molecular basis of ATM-dependent dimerization of the Mdc1 DNA damage checkpoint mediator. Nucleic Acids Res., 40, 2012
4QPO	Mechanistic basis of plasmid-specific DNA binding of the F plasmid regulatory protein, TraM Descriptor: PHOSPHATE ION, Relaxosome protein TraM Authors: Peng, Y, Lu, J, Wong, J, Edwards, R.A, Frost, L.S, Glover, J.N.M. Deposit date: 2014-06-24 Release date: 2014-09-03 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.999 Å) Cite: Mechanistic Basis of Plasmid-Specific DNA Binding of the F Plasmid Regulatory Protein, TraM. J.Mol.Biol., 426, 2014
1XPA	SOLUTION STRUCTURE OF THE DNA-AND RPA-BINDING DOMAIN OF THE HUMAN REPAIR FACTOR XPA, NMR, 1 STRUCTURE Descriptor: XPA, ZINC ION Authors: Ikegami, T, Kuraoka, I, Saijo, M, Kodo, N, Kyogoku, Y, Morikawa, K, Tanaka, K, Shirakawa, M. Deposit date: 1998-07-06 Release date: 1999-07-22 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of the DNA- and RPA-binding domain of the human repair factor XPA. Nat.Struct.Biol., 5, 1998
4EEQ	Crystal structure of E. faecalis DNA ligase with inhibitor Descriptor: 4-amino-2-(cyclopentyloxy)pyrimidine-5-carboxamide, BETA-NICOTINAMIDE RIBOSE MONOPHOSPHATE, DNA ligase, ... Authors: Wang, T, Charifson, P, Wei, Y. Deposit date: 2012-03-28 Release date: 2013-04-03 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.1 Å) Cite: Design, Synthesis and Activity Evaluation of Potent NAD+ DNA Ligase Inhibitors as Potential Antibacterial Agents. To be Published
5ZT2	Crystal structure of CCG DNA repeats at 1.66 angstrom resolution Descriptor: COBALT (II) ION, DNA (5'-D(*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*A)-3') Authors: Hou, M.H, Wu, P.C, Satange, R.B, Chen, Y.W. Deposit date: 2018-05-01 Release date: 2019-05-15 Last modified: 2024-03-27 Method: X-RAY DIFFRACTION (1.66002166 Å) Cite: Crystallographic analysis of conformational change in CCG repeats into i-motif and unusual DNA duplex in presence and absence of CoII(Chro)2 complex To Be Published
4EFE	crystal structure of DNA ligase Descriptor: BETA-NICOTINAMIDE RIBOSE MONOPHOSPHATE, DNA ligase, SULFATE ION, ... Authors: Wei, Y, Wang, T, Charifson, P, Xu, W. Deposit date: 2012-03-29 Release date: 2013-04-03 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2 Å) Cite: crystal structure of DNA ligase To be Published
1HMY	CRYSTAL STRUCTURE OF THE HHAI DNA METHYLTRANSFERASE COMPLEXED WITH S-ADENOSYL-L-METHIONINE Descriptor: HaeIII METHYLTRANSFERASE, S-ADENOSYLMETHIONINE Authors: Cheng, X. Deposit date: 1993-08-05 Release date: 1993-10-31 Last modified: 2024-06-05 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystal structure of the HhaI DNA methyltransferase complexed with S-adenosyl-L-methionine. Cell(Cambridge,Mass.), 74, 1993
1QMS	Head-to-Tail Dimer of Calicheamicin gamma-1-I Oligosaccharide Bound to DNA Duplex, NMR, 9 Structures Descriptor: CALICHEAMICIN GAMMA-1-OLIGOSACCHARIDE, DNA (5'-D(*GP*CP*AP*CP*CP*TP*TP*CP*CP*TP*GP*C)-3'), DNA (5'-D(*GP*CP*AP*GP*GP*AP*AP*GP*GP*TP*GP*C)-3'), ... Authors: Bifulco, G, Galeone, A, Nicolaou, K.C, Chazin, W.J, Gomez-Paloma, L. Deposit date: 1999-10-06 Release date: 1999-10-12 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution Structure of the Complex between the Head-to-Tail Dimer of Calicheamicin Gamma-1-I Oligosaccharide and a DNA Duplex Containing D(ACCT) and D(TCCT) High-Affinity Binding Sites J.Am.Chem.Soc., 120, 1998
1OSR	Structural study of dna duplex containaing a n-(2-deoxy-beta-erytho-pentofuranosyl) formamide frameshift by nmr and restrained molecular dynamics Descriptor: 5'-D(*AP*GP*GP*AP*CP*CP*AP*CP*G)-3', 5'-D(*CP*GP*TP*GP*GP*(2DF)P*TP*CP*CP*T)-3' Authors: Maufrais, C, Fazakerley, G.V, Cadet, J, Boulard, Y. Deposit date: 2003-03-20 Release date: 2003-10-14 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Structural study of DNA duplex containing an N-(2-deoxy-beta-D-erythro-pentofuranosyl) formamide frameshift by NMR and restrained molecular dynamics. Nucleic Acids Res., 31, 2003
1WTB	Complex structure of the C-terminal RNA-binding domain of hnRNP D (AUF1) with telomere DNA Descriptor: 5'-D(P*TP*AP*GP*G)-3', Heterogeneous nuclear ribonucleoprotein D0 Authors: Enokizono, Y, Konishi, Y, Nagata, K, Ouhashi, K, Uesugi, S, Ishikawa, F, Katahira, M. Deposit date: 2004-11-22 Release date: 2005-04-05 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Structure of hnRNP D complexed with single-stranded telomere DNA and unfolding of the quadruplex by heterogeneous nuclear ribonucleoprotein D J.Biol.Chem., 280, 2005
1X0F	Complex structure of the C-terminal RNA-binding domain of hnRNP D(AUF1) with telomeric DNA Descriptor: 5'-D(P*TP*AP*GP*G)-3', Heterogeneous nuclear ribonucleoprotein D0 Authors: Enokizono, Y, Konishi, Y, Nagata, K, Ouhashi, K, Uesugi, S, Ishikawa, F, Katahira, M. Deposit date: 2005-03-22 Release date: 2005-04-05 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Structure of hnRNP D complexed with single-stranded telomere DNA and unfolding of the quadruplex by heterogeneous nuclear ribonucleoprotein D. J.Biol.Chem., 280, 2005

<331332333334335336337338339340341342343344345346>