2GM0
 
 | | Linear dimer of stemloop SL1 from HIV-1 | | Descriptor: | RNA (35-MER) | | Authors: | Ulyanov, N.B, Mujeeb, A, Du, Z, Tonelli, M, Parslow, T.G, James, T.L. | | Deposit date: | 2006-04-05 | | Release date: | 2006-04-25 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | NMR Structure of the Full-length Linear Dimer of Stem-Loop-1 RNA in the HIV-1 Dimer Initiation Site.
J.Biol.Chem., 281, 2006
|
|
1JVE
 | |
1SLS
 | | IMMOBILE SLIPPED-LOOP STRUCTURE (SLS) OF DNA HOMODIMER IN SOLUTION, NMR, 9 STRUCTURES | | Descriptor: | OLIGODEOXYRIBONUCLEOTIDE | | Authors: | Ulyanov, N.B, Ivanov, V.I, Minyat, E.E, Khomyakova, E.B, Petrova, M.V, Lesiak, K, James, T.L. | | Deposit date: | 1997-09-30 | | Release date: | 1998-04-08 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | A pseudosquare knot structure of DNA in solution.
Biochemistry, 37, 1998
|
|
1B10
 | | SOLUTION NMR STRUCTURE OF RECOMBINANT SYRIAN HAMSTER PRION PROTEIN RPRP(90-231) , 25 STRUCTURES | | Descriptor: | PROTEIN (PRION PROTEIN) | | Authors: | James, T.L, Liu, H, Ulyanov, N.B, Farr-Jones, S. | | Deposit date: | 1998-11-25 | | Release date: | 1998-12-02 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of a 142-residue recombinant prion protein corresponding to the infectious fragment of the scrapie isoform.
Proc.Natl.Acad.Sci.USA, 94, 1997
|
|
1MFJ
 | |
2M8K
 | | A pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo | | Descriptor: | RNA (48-MER) | | Authors: | Cash, D.D, Cohen, O, Kim, N, Shefer, K, Brown, Y, Ulyanov, N.B, Tzfati, Y, Feigon, J. | | Deposit date: | 2013-05-22 | | Release date: | 2013-06-19 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Pyrimidine motif triple helix in the Kluyveromyces lactis telomerase RNA pseudoknot is essential for function in vivo.
Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1TXS
 | | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | | Descriptor: | Enteroviral 5'-UTR | | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | | Deposit date: | 2004-07-06 | | Release date: | 2004-10-05 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses
Biochemistry, 43, 2004
|
|
