6W3N
APE1 exonuclease substrate complex D148E
Summary for 6W3N
Entry DOI | 10.2210/pdb6w3n/pdb |
Descriptor | TCGACGGATCC, DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3'), GGATCCGTCGATCGCATCAGC, ... (7 entities in total) |
Functional Keywords | nuclease, abasic site, dna repair, dna binding protein, dna binding protein-dna complex, dna binding protein/dna |
Biological source | Homo sapiens (Human) More |
Total number of polymer chains | 5 |
Total formula weight | 75342.68 |
Authors | Freudenthal, B.D.,Whitaker, A.M. (deposition date: 2020-03-09, release date: 2020-06-10, Last modification date: 2023-10-18) |
Primary citation | Whitaker, A.M.,Stark, W.J.,Flynn, T.S.,Freudenthal, B.D. Molecular and structural characterization of disease-associated APE1 polymorphisms. DNA Repair (Amst.), 91-92:102867-102867, 2020 Cited by PubMed: 32454397DOI: 10.1016/j.dnarep.2020.102867 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.69 Å) |
Structure validation
Download full validation report![Download](/newweb/media/icons/dl.png)
![Download](/newweb/media/icons/dl.png)