1OLD
NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES
Summary for 1OLD
| Entry DOI | 10.2210/pdb1old/pdb |
| Descriptor | DNA (GATCGAAACGTAGCGCCTTCGATC), ARGININEAMIDE (2 entities in total) |
| Functional Keywords | deoxyribonucleic acid, dna |
| Total number of polymer chains | 1 |
| Total formula weight | 7528.98 |
| Authors | Lin, C.H.,Patel, D.J. (deposition date: 1996-10-31, release date: 1997-04-21, Last modification date: 2024-05-22) |
| Primary citation | Lin, C.H.,Patel, D.J. Encapsulating an amino acid in a DNA fold. Nat.Struct.Biol., 3:1046-1050, 1996 Cited by PubMed Abstract: Here we present the first solution structure of a ligand-DNA aptamer complex. Our NMR-molecular dynamics structural studies of the interaction between argininamide and a DNA stem-loop complex establishes that the hairpin loop DNA binding site undergoes an adaptive conformational transition on complex formation. The tip of the DNA loop folds down towards the stem and sandwiches the bound argininamide between reversed Hoogsteen A.C and Watson-Crick G.C base pairs. The argininamide is encapsulated within the structured DNA loop and is stabilized by an intricate set of intermolecular hydrogen bonds and stacking interactions. The structure of the complex lays out the molecular principles defining both the architecture of the internal cavity and the recognition elements that could contribute to ligand discrimination. PubMed: 8946859DOI: 10.1038/nsb1296-1046 PDB entries with the same primary citation |
| Experimental method | SOLUTION NMR |
Structure validation
Download full validation report
