1FG0

LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND

Summary for 1FG0

Related1FFK 1FFZ
Descriptor23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' (2 entities in total)
Functional Keywordsribosome assembly, rna-rna, ribozyme, a-site, ribosome
Biological sourceHaloarcula marismortui
Total number of polymer chains2
Total molecular weight205990.54
Authors
Nissen, P.,Hansen, J.,Ban, N.,Moore, P.B.,Steitz, T.A. (deposition date: 2000-07-26, release date: 2000-08-28, Last modification date: 2011-07-13)
Primary citation
Nissen, P.,Hansen, J.,Ban, N.,Moore, P.B.,Steitz, T.A.
The structural basis of ribosome activity in peptide bond synthesis.
Science, 289:920-930, 2000
PubMed: 10937990 (PDB entries with the same primary citation)
DOI: 10.1126/science.289.5481.920
MImport into Mendeley
Experimental method
X-RAY DIFFRACTION (3 Å)
?

Structure validation

ClashscoreRNA backbone370.62MetricValuePercentile RanksWorseBetterPercentile relative to all X-ray structuresPercentile relative to X-ray structures of similar resolution

More Asymmetric unit images

Molmil generated image of 1fg0
no rotation
Molmil generated image of 1fg0
rotated about x axis by 90°
Molmil generated image of 1fg0
rotated about y axis by 90°