[English] 日本語
Yorodumi
- PDB-8a9j: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8a9j
TitleCryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 without ML323 (consensus reconstruction)
Components
  • (Fanconi anemia group ...) x 2
  • DNA (61-MER)
  • Polyubiquitin-C
  • Ubiquitin carboxyl-terminal hydrolase 1
  • WD repeat-containing protein 48
KeywordsHYDROLASE / Deubiquitinase / Complex / Enzyme-Substrate / Inhibitor
Function / homology
Function and homology information


regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / double-strand break repair involved in meiotic recombination ...regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / double-strand break repair involved in meiotic recombination / brain morphogenesis / deubiquitinase activator activity / DNA repair complex / mitotic intra-S DNA damage checkpoint signaling / skeletal system morphogenesis / skin development / seminiferous tubule development / homeostasis of number of cells / protein deubiquitination / embryonic organ development / single fertilization / regulation of DNA repair / interstrand cross-link repair / response to UV / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / IRAK2 mediated activation of TAK1 complex / Prevention of phagosomal-lysosomal fusion / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Negative regulation of FLT3 / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Constitutive Signaling by NOTCH1 HD Domain Mutants / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Regulation of FZD by ubiquitination / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / TRAF6-mediated induction of TAK1 complex within TLR4 complex / NF-kB is activated and signals survival / Regulation of pyruvate metabolism / Pexophagy / Regulation of innate immune responses to cytosolic DNA / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Regulation of PTEN localization / VLDLR internalisation and degradation / Activated NOTCH1 Transmits Signal to the Nucleus / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / positive regulation of epithelial cell proliferation / positive regulation of protein ubiquitination / Translesion synthesis by REV1 / Regulation of BACH1 activity / TICAM1, RIP1-mediated IKK complex recruitment / Translesion synthesis by POLK / InlB-mediated entry of Listeria monocytogenes into host cell / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Downregulation of TGF-beta receptor signaling / Josephin domain DUBs / Translesion synthesis by POLI / IKK complex recruitment mediated by RIP1 / Gap-filling DNA repair synthesis and ligation in GG-NER / PINK1-PRKN Mediated Mitophagy / Regulation of activated PAK-2p34 by proteasome mediated degradation / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / response to gamma radiation / TNFR1-induced NF-kappa-B signaling pathway / TCF dependent signaling in response to WNT / skeletal system development / Autodegradation of Cdh1 by Cdh1:APC/C / positive regulation of receptor signaling pathway via JAK-STAT / Regulation of NF-kappa B signaling / APC/C:Cdc20 mediated degradation of Securin / activated TAK1 mediates p38 MAPK activation / ubiquitin binding / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Asymmetric localization of PCP proteins / TP53 Regulates Transcription of DNA Repair Genes / Ubiquitin-dependent degradation of Cyclin D / Regulation of signaling by CBL
Similarity search - Function
WDR48/Bun107 / Ubiquitin specific peptidase 1 / : / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain ...WDR48/Bun107 / Ubiquitin specific peptidase 1 / : / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 / FANCI solenoid 2 / FANCI solenoid 3 / FANCI solenoid 4 / FANCI helical domain 1 / FANCI helical domain 2 / Fanconi anaemia protein FANCD2 / Fanconi anaemia protein FancD2 nuclease / : / Ubiquitin specific protease (USP) domain signature 2. / Ubiquitin specific protease (USP) domain signature 1. / Ubiquitin specific protease, conserved site / Peptidase C19, ubiquitin carboxyl-terminal hydrolase / Ubiquitin carboxyl-terminal hydrolase / Ubiquitin specific protease domain / Ubiquitin specific protease (USP) domain profile. / Phosphatidylinositol 3-kinase Catalytic Subunit; Chain A, domain 1 / Papain-like cysteine peptidase superfamily / : / Ubiquitin-like (UB roll) / Ubiquitin domain signature. / Ubiquitin conserved site / Ubiquitin domain / Ubiquitin family / Ubiquitin homologues / Ubiquitin domain profile. / Ubiquitin-like domain / WD domain, G-beta repeat / Ubiquitin-like domain superfamily / G-protein beta WD-40 repeat / WD40 repeat, conserved site / Trp-Asp (WD) repeats signature. / Trp-Asp (WD) repeats profile. / Trp-Asp (WD) repeats circular profile. / WD40 repeats / WD40 repeat / WD40-repeat-containing domain superfamily / WD40/YVTN repeat-like-containing domain superfamily / Roll / Alpha Beta
Similarity search - Domain/homology
DNA / DNA (> 10) / Ubiquitin carboxyl-terminal hydrolase 1 / Polyubiquitin-C / WD repeat-containing protein 48 / Fanconi anemia group D2 protein / Fanconi anemia group I protein
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.8 Å
AuthorsRennie, M.L. / Walden, H.
Funding supportEuropean Union, United Kingdom, 2items
OrganizationGrant numberCountry
European Research Council (ERC)ERC-2015-CoG-681582European Union
Medical Research Council (MRC, United Kingdom)MC_UU_12016/12 United Kingdom
CitationJournal: Sci Adv / Year: 2022
Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site.
Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden /
Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1.
History
DepositionJun 28, 2022Deposition site: PDBE / Processing site: PDBE
Revision 1.0Oct 12, 2022Provider: repository / Type: Initial release
Revision 1.1Nov 13, 2024Group: Data collection / Refinement description / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / em_3d_fitting_list / em_admin / pdbx_entry_details / pdbx_initial_refinement_model / pdbx_modification_feature
Item: _em_3d_fitting_list.accession_code / _em_3d_fitting_list.initial_refinement_model_id ..._em_3d_fitting_list.accession_code / _em_3d_fitting_list.initial_refinement_model_id / _em_3d_fitting_list.source_name / _em_3d_fitting_list.type / _em_admin.last_update / _pdbx_entry_details.has_protein_modification

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Fanconi anemia group I protein
B: Fanconi anemia group D2 protein
C: Polyubiquitin-C
D: Ubiquitin carboxyl-terminal hydrolase 1
E: WD repeat-containing protein 48
S: DNA (61-MER)
T: DNA (61-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)501,0708
Polymers501,0057
Non-polymers651
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: gel filtration
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Fanconi anemia group ... , 2 types, 2 molecules AB

#1: Protein Fanconi anemia group I protein / Protein FACI


Mass: 150459.125 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9NVI1
#2: Protein Fanconi anemia group D2 protein / Protein FACD2


Mass: 164623.828 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: Ubiquitin conjugated to K561 / Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9BXW9

-
Protein , 3 types, 3 molecules CDE

#3: Protein Polyubiquitin-C


Mass: 8875.125 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: P0CG48
#4: Protein Ubiquitin carboxyl-terminal hydrolase 1 / Deubiquitinating enzyme 1 / hUBP / Ubiquitin thioesterase 1 / Ubiquitin-specific-processing protease 1


Mass: 88390.273 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: O94782, ubiquitinyl hydrolase 1
#5: Protein WD repeat-containing protein 48 / USP1-associated factor 1 / WD repeat endosomal protein / p80


Mass: 78300.656 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q8TAF3

-
DNA chain / Non-polymers , 2 types, 3 molecules ST

#6: DNA chain DNA (61-MER)


Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT
Source: (synth.) synthetic construct (others)
#7: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Zn

-
Details

Has ligand of interestN
Has protein modificationY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1USP1(C90S)-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 with dsDNACOMPLEX#1-#60MULTIPLE SOURCES
2Fanconi anemia group I protein, Fanconi anemia group D2 protein with ubiquitin conjugated to K561, Ubiquitin carboxyl-terminal hydrolase 1, WD repeat-containing protein 48COMPLEX#1-#61RECOMBINANT
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Spodoptera frugiperda (fall armyworm)
Buffer solutionpH: 8
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323
VitrificationCryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K / Details: blotted for 3.0 secs before plunging

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 1000 nm
Image recordingElectron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.19.2_4158: / Classification: refinement
EM software
IDNameVersionCategory
4cryoSPARCCTF correction
7Coot0.9.6model fitting
9cryoSPARCinitial Euler assignment
10cryoSPARCfinal Euler assignment
12cryoSPARC3D reconstruction
13PHENIX1.19model refinement
Image processingDetails: 2x binning
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 6716868
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 2.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 583484 / Symmetry type: POINT
Atomic model buildingB value: 94.9 / Space: REAL
Atomic model building

3D fitting-ID: 1 / Source name: PDB / Type: experimental model

IDPDB-IDPdb chain-IDAccession codeInitial refinement model-ID
17AY1A7AY11
27AY1B7AY11
37AY1E7AY11
47ZH37ZH32
56VAES6VAE3
66VAET6VAE3
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00325348
ELECTRON MICROSCOPYf_angle_d0.57634509
ELECTRON MICROSCOPYf_dihedral_angle_d16.2379527
ELECTRON MICROSCOPYf_chiral_restr0.0424046
ELECTRON MICROSCOPYf_plane_restr0.0044124

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more