[English] 日本語
Yorodumi
- PDB-8a9j: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8a9j
TitleCryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 without ML323 (consensus reconstruction)
Components
  • (Fanconi anemia group ...) x 2
  • DNA (61-MER)
  • Polyubiquitin-C
  • Ubiquitin carboxyl-terminal hydrolase 1
  • WD repeat-containing protein 48
KeywordsHYDROLASE / Deubiquitinase / Complex / Enzyme-Substrate / Inhibitor
Function / homology
Function and homology information


positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / gamete generation / neuronal stem cell population maintenance ...positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / gamete generation / neuronal stem cell population maintenance / deubiquitinase activator activity / brain morphogenesis / DNA repair complex / mitotic intra-S DNA damage checkpoint signaling / skeletal system morphogenesis / skin development / positive regulation of double-strand break repair via homologous recombination / seminiferous tubule development / protein deubiquitination / single fertilization / homeostasis of number of cells / embryonic organ development / regulation of DNA repair / interstrand cross-link repair / DNA polymerase binding / response to UV / condensed chromosome / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Membrane binding and targetting of GAG proteins / Constitutive Signaling by NOTCH1 HD Domain Mutants / Endosomal Sorting Complex Required For Transport (ESCRT) / NOTCH2 Activation and Transmission of Signal to the Nucleus / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Negative regulation of FLT3 / Regulation of FZD by ubiquitination / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Downregulation of ERBB4 signaling / p75NTR recruits signalling complexes / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / APC-Cdc20 mediated degradation of Nek2A / PINK1-PRKN Mediated Mitophagy / TRAF6-mediated induction of TAK1 complex within TLR4 complex / InlA-mediated entry of Listeria monocytogenes into host cells / Pexophagy / Regulation of innate immune responses to cytosolic DNA / VLDLR internalisation and degradation / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Activated NOTCH1 Transmits Signal to the Nucleus / Translesion synthesis by REV1 / NF-kB is activated and signals survival / Regulation of PTEN localization / Translesion synthesis by POLK / Regulation of BACH1 activity / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / MAP3K8 (TPL2)-dependent MAPK1/3 activation / TICAM1, RIP1-mediated IKK complex recruitment / Downregulation of TGF-beta receptor signaling / Josephin domain DUBs / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Regulation of activated PAK-2p34 by proteasome mediated degradation / InlB-mediated entry of Listeria monocytogenes into host cell / IKK complex recruitment mediated by RIP1 / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Autodegradation of Cdh1 by Cdh1:APC/C / TNFR1-induced NF-kappa-B signaling pathway / ubiquitin binding / APC/C:Cdc20 mediated degradation of Securin / positive regulation of protein ubiquitination / Asymmetric localization of PCP proteins / TCF dependent signaling in response to WNT / SCF-beta-TrCP mediated degradation of Emi1 / Regulation of NF-kappa B signaling / NIK-->noncanonical NF-kB signaling / skeletal system development / Ubiquitin-dependent degradation of Cyclin D / AUF1 (hnRNP D0) binds and destabilizes mRNA / Negative regulators of DDX58/IFIH1 signaling / positive regulation of epithelial cell proliferation / TNFR2 non-canonical NF-kB pathway / NOTCH3 Activation and Transmission of Signal to the Nucleus / activated TAK1 mediates p38 MAPK activation / Assembly of the pre-replicative complex
Similarity search - Function
Ubiquitin specific peptidase 1 / WDR48/Bun107 / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain ...Ubiquitin specific peptidase 1 / WDR48/Bun107 / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 / FANCI solenoid 2 / FANCI solenoid 3 / FANCI solenoid 4 / FANCI helical domain 1 / FANCI helical domain 2 / Fanconi anaemia protein FANCD2 / Fanconi anaemia protein FancD2 nuclease / Ubiquitin specific protease (USP) domain signature 2. / Ubiquitin specific protease (USP) domain signature 1. / Ubiquitin specific protease, conserved site / Peptidase C19, ubiquitin carboxyl-terminal hydrolase / Ubiquitin carboxyl-terminal hydrolase / Ubiquitin specific protease domain / Ubiquitin specific protease (USP) domain profile. / Papain-like cysteine peptidase superfamily / Ubiquitin conserved site / Ubiquitin domain / Ubiquitin domain signature. / Ubiquitin family / Ubiquitin homologues / Ubiquitin-like domain / Ubiquitin domain profile. / G-protein beta WD-40 repeat / Ubiquitin-like domain superfamily / WD40 repeat, conserved site / Trp-Asp (WD) repeats signature. / WD domain, G-beta repeat / WD40 repeats / WD40 repeat / Trp-Asp (WD) repeats profile. / Trp-Asp (WD) repeats circular profile. / WD40-repeat-containing domain superfamily / WD40/YVTN repeat-like-containing domain superfamily
Similarity search - Domain/homology
DNA / DNA (> 10) / Ubiquitin carboxyl-terminal hydrolase 1 / Polyubiquitin-C / WD repeat-containing protein 48 / Fanconi anemia group D2 protein / Fanconi anemia group I protein
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.8 Å
AuthorsRennie, M.L. / Walden, H.
Funding supportEuropean Union, United Kingdom, 2items
OrganizationGrant numberCountry
European Research Council (ERC)ERC-2015-CoG-681582European Union
Medical Research Council (MRC, United Kingdom)MC_UU_12016/12 United Kingdom
CitationJournal: Sci Adv / Year: 2022
Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site.
Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden /
Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1.
History
DepositionJun 28, 2022Deposition site: PDBE / Processing site: PDBE
Revision 1.0Oct 12, 2022Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Fanconi anemia group I protein
B: Fanconi anemia group D2 protein
C: Polyubiquitin-C
D: Ubiquitin carboxyl-terminal hydrolase 1
E: WD repeat-containing protein 48
S: DNA (61-MER)
T: DNA (61-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)501,0708
Polymers501,0057
Non-polymers651
Water0
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: gel filtration
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Fanconi anemia group ... , 2 types, 2 molecules AB

#1: Protein Fanconi anemia group I protein / Protein FACI


Mass: 150459.125 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9NVI1
#2: Protein Fanconi anemia group D2 protein / Protein FACD2


Mass: 164623.828 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: Ubiquitin conjugated to K561 / Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9BXW9

-
Protein , 3 types, 3 molecules CDE

#3: Protein Polyubiquitin-C


Mass: 8875.125 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: P0CG48
#4: Protein Ubiquitin carboxyl-terminal hydrolase 1 / Deubiquitinating enzyme 1 / hUBP / Ubiquitin thioesterase 1 / Ubiquitin-specific-processing protease 1


Mass: 88390.273 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: O94782, ubiquitinyl hydrolase 1
#5: Protein WD repeat-containing protein 48 / USP1-associated factor 1 / WD repeat endosomal protein / p80


Mass: 78300.656 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q8TAF3

-
DNA chain / Non-polymers , 2 types, 3 molecules ST

#6: DNA chain DNA (61-MER)


Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT
Source: (synth.) synthetic construct (others)
#7: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Zn

-
Details

Has ligand of interestN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1USP1(C90S)-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 with dsDNACOMPLEX#1-#60MULTIPLE SOURCES
2Fanconi anemia group I protein, Fanconi anemia group D2 protein with ubiquitin conjugated to K561, Ubiquitin carboxyl-terminal hydrolase 1, WD repeat-containing protein 48COMPLEX#1-#61RECOMBINANT
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Spodoptera frugiperda (fall armyworm)
Buffer solutionpH: 8
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323
VitrificationCryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K / Details: blotted for 3.0 secs before plunging

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELDBright-field microscopy / Nominal defocus max: 3000 nm / Nominal defocus min: 1000 nm
Image recordingElectron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.19.2_4158: / Classification: refinement
EM software
IDNameVersionCategory
4cryoSPARCCTF correction
7Coot0.9.6model fitting
9cryoSPARCinitial Euler assignment
10cryoSPARCfinal Euler assignment
12cryoSPARC3D reconstruction
13PHENIX1.19model refinement
Image processingDetails: 2x binning
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 6716868
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 2.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 583484 / Symmetry type: POINT
Atomic model buildingB value: 94.9 / Space: REAL
Atomic model building
IDPDB-IDPdb chain-ID 3D fitting-ID
17AY1

7ay1

A1
27AY1

7ay1

B1
37AY1

7ay1

E1
47ZH3

7zh3

1
56VAE

6vae

S1
66VAE

6vae

T1
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00325348
ELECTRON MICROSCOPYf_angle_d0.57634509
ELECTRON MICROSCOPYf_dihedral_angle_d16.2379527
ELECTRON MICROSCOPYf_chiral_restr0.0424046
ELECTRON MICROSCOPYf_plane_restr0.0044124

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more