[English] 日本語
Yorodumi- PDB-8a9j: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 8a9j | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 without ML323 (consensus reconstruction) | |||||||||
Components |
| |||||||||
Keywords | HYDROLASE / Deubiquitinase / Complex / Enzyme-Substrate / Inhibitor | |||||||||
| Function / homology | Function and homology informationregulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance ...regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / brain morphogenesis / deubiquitinase activator activity / DNA repair complex / mitotic intra-S DNA damage checkpoint signaling / skeletal system morphogenesis / skin development / seminiferous tubule development / homeostasis of number of cells / protein deubiquitination / embryonic organ development / single fertilization / interstrand cross-link repair / regulation of DNA repair / response to UV / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Negative regulation of FLT3 / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / Constitutive Signaling by NOTCH1 HD Domain Mutants / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Downregulation of ERBB4 signaling / Regulation of FZD by ubiquitination / APC-Cdc20 mediated degradation of Nek2A / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / TRAF6-mediated induction of TAK1 complex within TLR4 complex / Regulation of pyruvate metabolism / NF-kB is activated and signals survival / Regulation of innate immune responses to cytosolic DNA / Downregulation of ERBB2:ERBB3 signaling / Pexophagy / NRIF signals cell death from the nucleus / VLDLR internalisation and degradation / Regulation of PTEN localization / Activated NOTCH1 Transmits Signal to the Nucleus / Regulation of BACH1 activity / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Translesion synthesis by REV1 / TICAM1, RIP1-mediated IKK complex recruitment / InlB-mediated entry of Listeria monocytogenes into host cell / Translesion synthesis by POLK / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Downregulation of TGF-beta receptor signaling / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / Josephin domain DUBs / Translesion synthesis by POLI / Regulation of activated PAK-2p34 by proteasome mediated degradation / Gap-filling DNA repair synthesis and ligation in GG-NER / IKK complex recruitment mediated by RIP1 / ubiquitin binding / positive regulation of protein ubiquitination / positive regulation of epithelial cell proliferation / PINK1-PRKN Mediated Mitophagy / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / TNFR1-induced NF-kappa-B signaling pathway / Autodegradation of Cdh1 by Cdh1:APC/C / response to gamma radiation / skeletal system development / APC/C:Cdc20 mediated degradation of Securin / TCF dependent signaling in response to WNT / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Regulation of NF-kappa B signaling / Asymmetric localization of PCP proteins / Ubiquitin-dependent degradation of Cyclin D / activated TAK1 mediates p38 MAPK activation / SCF-beta-TrCP mediated degradation of Emi1 / NIK-->noncanonical NF-kB signaling / TNFR2 non-canonical NF-kB pathway Similarity search - Function | |||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.8 Å | |||||||||
Authors | Rennie, M.L. / Walden, H. | |||||||||
| Funding support | European Union, United Kingdom, 2items
| |||||||||
Citation | Journal: Sci Adv / Year: 2022Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden / ![]() Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1. | |||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 8a9j.cif.gz | 574.6 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb8a9j.ent.gz | 443.7 KB | Display | PDB format |
| PDBx/mmJSON format | 8a9j.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Summary document | 8a9j_validation.pdf.gz | 1.4 MB | Display | wwPDB validaton report |
|---|---|---|---|---|
| Full document | 8a9j_full_validation.pdf.gz | 1.4 MB | Display | |
| Data in XML | 8a9j_validation.xml.gz | 87.5 KB | Display | |
| Data in CIF | 8a9j_validation.cif.gz | 131.8 KB | Display | |
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/a9/8a9j ftp://data.pdbj.org/pub/pdb/validation_reports/a9/8a9j | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 15284MC ![]() 7zh3C ![]() 7zh4C ![]() 8a9kC C: citing same article ( M: map data used to model this data |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
| #1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: ![]() |
|---|---|
| #2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: Ubiquitin conjugated to K561 / Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: ![]() |
-Protein , 3 types, 3 molecules CDE
| #3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: ![]() |
|---|---|
| #4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: ![]() |
| #5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Production host: ![]() |
-DNA chain / Non-polymers , 2 types, 3 molecules ST

| #6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) #7: Chemical | ChemComp-ZN / | |
|---|
-Details
| Has ligand of interest | N |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source (natural) | Organism: Homo sapiens (human) | ||||||||||||||||||
| Source (recombinant) | Organism: ![]() | ||||||||||||||||||
| Buffer solution | pH: 8 | ||||||||||||||||||
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323 | ||||||||||||||||||
| Vitrification | Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K / Details: blotted for 3.0 secs before plunging |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 1000 nm |
| Image recording | Electron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
| Software | Name: PHENIX / Version: 1.19.2_4158: / Classification: refinement | |||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| |||||||||||||||||||||||||||||||||||
| Image processing | Details: 2x binning | |||||||||||||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | |||||||||||||||||||||||||||||||||||
| Particle selection | Num. of particles selected: 6716868 | |||||||||||||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | |||||||||||||||||||||||||||||||||||
| 3D reconstruction | Resolution: 2.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 583484 / Symmetry type: POINT | |||||||||||||||||||||||||||||||||||
| Atomic model building | B value: 94.9 / Space: REAL | |||||||||||||||||||||||||||||||||||
| Atomic model building | 3D fitting-ID: 1 / Source name: PDB / Type: experimental model
| |||||||||||||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 2items
Citation







PDBj





















































gel filtration




