[English] 日本語
Yorodumi- PDB-8a9j: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 8a9j | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 without ML323 (consensus reconstruction) | |||||||||
Components |
| |||||||||
Keywords | HYDROLASE / Deubiquitinase / Complex / Enzyme-Substrate / Inhibitor | |||||||||
| Function / homology | Function and homology informationpositive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / homologous chromosome pairing at meiosis / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / deubiquitinase activator activity / mitotic intra-S DNA damage checkpoint signaling / response to UV / protein deubiquitination / interstrand cross-link repair ...positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / homologous chromosome pairing at meiosis / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / deubiquitinase activator activity / mitotic intra-S DNA damage checkpoint signaling / response to UV / protein deubiquitination / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / regulation of DNA repair / condensed chromosome / DNA polymerase binding / response to gamma radiation / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Prevention of phagosomal-lysosomal fusion / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / Negative regulation of FLT3 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Constitutive Signaling by NOTCH1 HD Domain Mutants / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / Regulation of FZD by ubiquitination / positive regulation of protein ubiquitination / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / NF-kB is activated and signals survival / TRAF6-mediated induction of TAK1 complex within TLR4 complex / Regulation of pyruvate metabolism / Pexophagy / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Regulation of PTEN localization / Regulation of innate immune responses to cytosolic DNA / VLDLR internalisation and degradation / Activated NOTCH1 Transmits Signal to the Nucleus / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by REV1 / TICAM1, RIP1-mediated IKK complex recruitment / Regulation of BACH1 activity / Translesion synthesis by POLK / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / InlB-mediated entry of Listeria monocytogenes into host cell / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / positive regulation of receptor signaling pathway via JAK-STAT / Translesion synthesis by POLI / Downregulation of TGF-beta receptor signaling / Josephin domain DUBs / Gap-filling DNA repair synthesis and ligation in GG-NER / IKK complex recruitment mediated by RIP1 / PINK1-PRKN Mediated Mitophagy / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / TNFR1-induced NF-kappa-B signaling pathway / TP53 Regulates Transcription of DNA Repair Genes / Regulation of activated PAK-2p34 by proteasome mediated degradation / TCF dependent signaling in response to WNT / Regulation of NF-kappa B signaling / activated TAK1 mediates p38 MAPK activation / ubiquitin binding / Autodegradation of Cdh1 by Cdh1:APC/C / APC/C:Cdc20 mediated degradation of Securin / regulation of protein stability / NOTCH3 Activation and Transmission of Signal to the Nucleus / Regulation of signaling by CBL / Negative regulators of DDX58/IFIH1 signaling / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Asymmetric localization of PCP proteins / Fanconi Anemia Pathway / Negative regulation of FGFR3 signaling / Ubiquitin-dependent degradation of Cyclin D / Deactivation of the beta-catenin transactivating complex / Peroxisomal protein import / SCF-beta-TrCP mediated degradation of Emi1 / NIK-->noncanonical NF-kB signaling / Stabilization of p53 / AUF1 (hnRNP D0) binds and destabilizes mRNA / TNFR2 non-canonical NF-kB pathway / Negative regulation of FGFR2 signaling / Negative regulation of FGFR4 signaling / Downregulation of SMAD2/3:SMAD4 transcriptional activity Similarity search - Function | |||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.8 Å | |||||||||
Authors | Rennie, M.L. / Walden, H. | |||||||||
| Funding support | European Union, United Kingdom, 2items
| |||||||||
Citation | Journal: Sci Adv / Year: 2022Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden / ![]() Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1. | |||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 8a9j.cif.gz | 574.6 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb8a9j.ent.gz | 443.7 KB | Display | PDB format |
| PDBx/mmJSON format | 8a9j.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/a9/8a9j ftp://data.pdbj.org/pub/pdb/validation_reports/a9/8a9j | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 15284MC ![]() 7zh3C ![]() 7zh4C ![]() 8a9kC C: citing same article ( M: map data used to model this data |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
| #1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: ![]() |
|---|---|
| #2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: Ubiquitin conjugated to K561 / Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: ![]() |
-Protein , 3 types, 3 molecules CDE
| #3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: ![]() |
|---|---|
| #4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: ![]() |
| #5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Production host: ![]() |
-DNA chain / Non-polymers , 2 types, 3 molecules ST

| #6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) #7: Chemical | ChemComp-ZN / | |
|---|
-Details
| Has ligand of interest | N |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source (natural) | Organism: Homo sapiens (human) | ||||||||||||||||||
| Source (recombinant) | Organism: ![]() | ||||||||||||||||||
| Buffer solution | pH: 8 | ||||||||||||||||||
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323 | ||||||||||||||||||
| Vitrification | Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K / Details: blotted for 3.0 secs before plunging |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 1000 nm |
| Image recording | Electron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
| Software | Name: PHENIX / Version: 1.19.2_4158: / Classification: refinement | |||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| |||||||||||||||||||||||||||||||||||
| Image processing | Details: 2x binning | |||||||||||||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | |||||||||||||||||||||||||||||||||||
| Particle selection | Num. of particles selected: 6716868 | |||||||||||||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | |||||||||||||||||||||||||||||||||||
| 3D reconstruction | Resolution: 2.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 583484 / Symmetry type: POINT | |||||||||||||||||||||||||||||||||||
| Atomic model building | B value: 94.9 / Space: REAL | |||||||||||||||||||||||||||||||||||
| Atomic model building | 3D fitting-ID: 1 / Source name: PDB / Type: experimental model
| |||||||||||||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 2items
Citation







PDBj





















































gel filtration




