[English] 日本語
Yorodumi
- PDB-7s7b: Human Nuclear exosome targeting (NEXT) complex homodimer bound to... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7s7b
TitleHuman Nuclear exosome targeting (NEXT) complex homodimer bound to RNA (substrate 1)
Components
  • Exosome RNA helicase MTR4
  • RNA (46-MER)
  • RNA-binding protein 7
  • Zinc finger CCHC domain-containing protein 8,Zinc finger CCHC domain-containing protein 8
KeywordsRNA BINDING PROTEIN/RNA / Helicase / ATPase / RNA / Exosome / RNA BINDING PROTEIN / RNA BINDING PROTEIN-RNA complex
Function / homology
Function and homology information


snRNA catabolic process / TRAMP complex / co-transcriptional lncRNA 3' end processing, cleavage and polyadenylation pathway / snRNA binding / Nuclear RNA decay / mRNA 3'-end processing / RNA catabolic process / maturation of 5.8S rRNA / regulation of alternative mRNA splicing, via spliceosome / pre-mRNA intronic binding ...snRNA catabolic process / TRAMP complex / co-transcriptional lncRNA 3' end processing, cleavage and polyadenylation pathway / snRNA binding / Nuclear RNA decay / mRNA 3'-end processing / RNA catabolic process / maturation of 5.8S rRNA / regulation of alternative mRNA splicing, via spliceosome / pre-mRNA intronic binding / RNA processing / Major pathway of rRNA processing in the nucleolus and cytosol / catalytic step 2 spliceosome / 14-3-3 protein binding / mRNA Splicing - Major Pathway / Regulation of endogenous retroelements by the Human Silencing Hub (HUSH) complex / mRNA splicing, via spliceosome / meiotic cell cycle / rRNA processing / RNA helicase activity / nuclear speck / single-stranded RNA binding / nuclear body / RNA helicase / DNA damage response / nucleolus / ATP hydrolysis activity / RNA binding / zinc ion binding / nucleoplasm / ATP binding / nucleus
Similarity search - Function
RBM7, RNA recognition motif / : / : / rRNA-processing arch domain / Mtr4-like, beta-barrel domain / ATP-dependent RNA helicase Ski2, C-terminal / ATP-dependent RNA helicase Ski2-like / : / DSHCT (NUC185) domain / Exosome RNA helicase MTR4-like, stalk ...RBM7, RNA recognition motif / : / : / rRNA-processing arch domain / Mtr4-like, beta-barrel domain / ATP-dependent RNA helicase Ski2, C-terminal / ATP-dependent RNA helicase Ski2-like / : / DSHCT (NUC185) domain / Exosome RNA helicase MTR4-like, stalk / DSHCT / : / PSP, proline-rich / PSP / proline-rich domain in spliceosome associated proteins / DEAD/DEAH box helicase domain / DEAD/DEAH box helicase / RNA recognition motif / RNA recognition motif / Eukaryotic RNA Recognition Motif (RRM) profile. / RNA recognition motif domain / RNA-binding domain superfamily / Helicase conserved C-terminal domain / zinc finger / Zinc knuckle / Zinc finger, CCHC-type / Zinc finger CCHC-type profile. / helicase superfamily c-terminal domain / Superfamilies 1 and 2 helicase C-terminal domain profile. / Superfamilies 1 and 2 helicase ATP-binding type-1 domain profile. / DEAD-like helicases superfamily / Helicase, C-terminal / Helicase superfamily 1/2, ATP-binding domain / Nucleotide-binding alpha-beta plait domain superfamily / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
RNA / RNA (> 10) / Exosome RNA helicase MTR4 / Zinc finger CCHC domain-containing protein 8 / RNA-binding protein 7
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.06 Å
AuthorsPuno, M.R. / Lima, C.D.
Funding support United States, 2items
OrganizationGrant numberCountry
Howard Hughes Medical Institute (HHMI) United States
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)GM118080 United States
CitationJournal: Cell / Year: 2022
Title: Structural basis for RNA surveillance by the human nuclear exosome targeting (NEXT) complex.
Authors: M Rhyan Puno / Christopher D Lima /
Abstract: RNA quality control relies on co-factors and adaptors to identify and prepare substrates for degradation by ribonucleases such as the 3' to 5' ribonucleolytic RNA exosome. Here, we determined ...RNA quality control relies on co-factors and adaptors to identify and prepare substrates for degradation by ribonucleases such as the 3' to 5' ribonucleolytic RNA exosome. Here, we determined cryogenic electron microscopy structures of human nuclear exosome targeting (NEXT) complexes bound to RNA that reveal mechanistic insights to substrate recognition and early steps that precede RNA handover to the exosome. The structures illuminate ZCCHC8 as a scaffold, mediating homodimerization while embracing the MTR4 helicase and flexibly anchoring RBM7 to the helicase core. All three subunits collaborate to bind the RNA, with RBM7 and ZCCHC8 surveying sequences upstream of the 3' end to facilitate RNA capture by MTR4. ZCCHC8 obscures MTR4 surfaces important for RNA binding and extrusion as well as MPP6-dependent recruitment and docking onto the RNA exosome core, interactions that contribute to RNA surveillance by coordinating RNA capture, translocation, and extrusion from the helicase to the exosome for decay.
History
DepositionSep 15, 2021Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jun 15, 2022Provider: repository / Type: Initial release
Revision 1.1Jun 22, 2022Group: Database references / Category: citation / citation_author
Item: _citation.journal_abbrev / _citation.journal_id_CSD ..._citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _citation_author.identifier_ORCID
Revision 1.2Jun 5, 2024Group: Data collection / Category: chem_comp_atom / chem_comp_bond

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Exosome RNA helicase MTR4
B: Zinc finger CCHC domain-containing protein 8,Zinc finger CCHC domain-containing protein 8
C: RNA-binding protein 7
D: RNA (46-MER)
E: Exosome RNA helicase MTR4
F: Zinc finger CCHC domain-containing protein 8,Zinc finger CCHC domain-containing protein 8
G: RNA-binding protein 7
H: RNA (46-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)423,23810
Polymers423,1078
Non-polymers1312
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein Exosome RNA helicase MTR4 / MTR4 / MTREX / ATP-dependent RNA helicase DOB1 / ATP-dependent RNA helicase SKIV2L2 / Superkiller ...MTR4 / MTREX / ATP-dependent RNA helicase DOB1 / ATP-dependent RNA helicase SKIV2L2 / Superkiller viralicidic activity 2-like 2 / TRAMP-like complex helicase


Mass: 118224.961 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: MTREX, DOB1, KIAA0052, MTR4, SKIV2L2 / Production host: Escherichia coli (E. coli) / References: UniProt: P42285, RNA helicase
#2: Protein Zinc finger CCHC domain-containing protein 8,Zinc finger CCHC domain-containing protein 8 / TRAMP-like complex RNA-binding factor ZCCHC8


Mass: 69259.805 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: ZCCHC8 / Production host: Escherichia coli (E. coli) / References: UniProt: Q6NZY4
#3: Protein RNA-binding protein 7 / RNA-binding motif protein 7


Mass: 9462.986 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RBM7 / Production host: Escherichia coli (E. coli) / References: UniProt: Q9Y580
#4: RNA chain RNA (46-MER)


Mass: 14605.818 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: The actual RNA sequence is: ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAA(2PU)ACAAAAAAAA. (2PU) is represented by "N" (any nucleotide. This residue is missing in the coordinates and the chemical is an ...Details: The actual RNA sequence is: ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAA(2PU)ACAAAAAAAA. (2PU) is represented by "N" (any nucleotide. This residue is missing in the coordinates and the chemical is an internal 2' pyrene modified uridine
Source: (synth.) synthetic construct (others)
#5: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Zn
Has ligand of interestN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: human Nuclear Exosome Targeting (NEXT)-RNA substrate 1 complex
Type: COMPLEX / Entity ID: #1-#4 / Source: RECOMBINANT
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 8
Details: 20 mM Tris-Cl pH 8.0, 50 mM NaCl, 0.1 mM TCEP supplemented with 0.02% (v/v) IGEPAL CA-630
SpecimenConc.: 8 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 295 K / Details: 30 s wait time, blot for 2.5 s before plunging

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD
Image recordingElectron dose: 67.6 e/Å2 / Detector mode: SUPER-RESOLUTION / Film or detector model: GATAN K2 SUMMIT (4k x 4k)

-
Processing

EM softwareName: RELION / Category: 3D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 4.06 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 618412
Details: A total of 618,412 particles were used for the consensus reconstruction with an overall resolution of 4.06 Angstrom (FSC 0.143 cut off). Focused 3D classification and local refinement were ...Details: A total of 618,412 particles were used for the consensus reconstruction with an overall resolution of 4.06 Angstrom (FSC 0.143 cut off). Focused 3D classification and local refinement were performed in several regions of the complex. A composite map was generated using focused reconstructions of ZCCHC8 HD/KID-MTR4 KOW (3.26 Angstrom, FSC = 0.143; 117,561 particles), protomer A MTR4 (3.42 Angstrom, FSC = 0.143; 225,213 particles), protomer B MTR4 (3.54 Angstrom, FSC = 0.143; 236,602 particles), protomer A MTR4 core-ZCCHC8 PSP-RBM7 RRM (4.06 Angstrom, FSC = 0.143; 44,800 particles), and protomer B MTR4 core-ZCCHC8 PSP-RBM7 RRM (4.4 Angstrom, FSC = 0.143 37,088 particles).
Symmetry type: POINT

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more