[English] 日本語

- PDB-6pw2: Structural Basis for Cooperative Binding of EBNA1 to the Epstein-... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 6pw2 | ||||||
---|---|---|---|---|---|---|---|
Title | Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr Virus Dyad Symmetry Minimal Origin of Replication | ||||||
![]() |
| ||||||
![]() | viral protein/dna / EBNA1 / DNA binding protein / Epstein-Barr Virus / viral protein / viral protein-dna complex | ||||||
Function / homology | ![]() host cell PML body / viral latency / Hydrolases; Acting on ester bonds; Endodeoxyribonucleases producing 5'-phosphomonoesters / symbiont-mediated disruption of host cell PML body / regulation of DNA replication / enzyme-substrate adaptor activity / endonuclease activity / symbiont-mediated suppression of host NF-kappaB cascade / DNA-binding transcription factor activity / positive regulation of DNA-templated transcription / DNA binding Similarity search - Function | ||||||
Biological species | ![]() ![]() | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Messick, T.E. / Malecka, K.A. / Lieberman, P.M. | ||||||
Funding support | ![]()
| ||||||
![]() | ![]() Title: Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr Virus Dyad Symmetry Minimal Origin of Replication. Authors: Malecka, K.A. / Dheekollu, J. / Deakyne, J.S. / Wiedmer, A. / Ramirez, U.D. / Lieberman, P.M. / Messick, T.E. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 683.1 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 558.2 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 503.4 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 529.7 KB | Display | |
Data in XML | ![]() | 48.3 KB | Display | |
Data in CIF | ![]() | 67.2 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 1b3tS S: Starting model for refinement |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | ![]()
| ||||||||||||
2 | ![]()
| ||||||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 16008.498 Da / Num. of mol.: 8 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Strain: B95-8 / Gene: EBNA1, BKRF1 / Production host: ![]() ![]() #2: DNA chain | Mass: 19128.277 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: CTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTA Source: (synth.) ![]() #3: DNA chain | Mass: 19084.285 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: CTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTA Source: (synth.) ![]() #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 3.02 Å3/Da / Density % sol: 59.27 % |
---|---|
Crystal grow | Temperature: 298 K / Method: vapor diffusion, hanging drop / pH: 6.75 / Details: 200 mM sodium malonate, 24% PEG 3350 / PH range: +/- 0.25 / Temp details: +/- 2 degrees |
-Data collection
Diffraction | Mean temperature: 100 K / Ambient temp details: Cryostream / Serial crystal experiment: N |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: DECTRIS PILATUS3 6M / Detector: PIXEL / Date: Nov 19, 2015 |
Radiation | Monochromator: Si (111) Rosenbaum-Rock double-crystal monochromator Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1 Å / Relative weight: 1 |
Reflection | Resolution: 3→50 Å / Num. obs: 29088 / % possible obs: 99.6 % / Redundancy: 10.6 % / Rsym value: 0.159 / Net I/σ(I): 8.1 |
Reflection shell | Resolution: 3→3.05 Å / Redundancy: 8.5 % / Mean I/σ(I) obs: 0.16 / Num. unique obs: 2264 / Rsym value: 2.682 / % possible all: 98.7 |
-
Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: 1B3T Resolution: 3.01→40.9 Å / Cross valid method: FREE R-VALUE Details: TLS record as of below: tls = "chain 'A' and (resid 461 through 477 )" tls = "chain 'A' and (resid 478 through 491 )" tls = "chain 'A' and (resid 492 through 504 )" tls = "chain 'A' and ...Details: TLS record as of below: tls = "chain 'A' and (resid 461 through 477 )" tls = "chain 'A' and (resid 478 through 491 )" tls = "chain 'A' and (resid 492 through 504 )" tls = "chain 'A' and (resid 505 through 547 )" tls = "chain 'A' and (resid 548 through 560 )" tls = "chain 'A' and (resid 561 through 583 )" tls = "chain 'A' and (resid 584 through 599 )" tls = "chain 'A' and (resid 600 through 607 )" tls = "chain 'B' and (resid 461 through 477 )" tls = "chain 'B' and (resid 478 through 489 )" tls = "chain 'B' and (resid 490 through 513 )" tls = "chain 'B' and (resid 514 through 547 )" tls = "chain 'B' and (resid 548 through 560 )" tls = "chain 'B' and (resid 561 through 585 )" tls = "chain 'B' and (resid 586 through 607 )" tls = "chain 'C' and (resid 461 through 470 )" tls = "chain 'C' and (resid 471 through 477 )" tls = "chain 'C' and (resid 478 through 489 )" tls = "chain 'C' and (resid 490 through 513 )" tls = "chain 'C' and (resid 514 through 560 )" tls = "chain 'C' and (resid 561 through 568 )" tls = "chain 'C' and (resid 569 through 583 )" tls = "chain 'C' and (resid 584 through 607 )" tls = "chain 'D' and (resid 461 through 477 )" tls = "chain 'D' and (resid 478 through 537 )" tls = "chain 'D' and (resid 538 through 607 )" tls = "chain 'E' and (resid 3 through 17 )" tls = "chain 'E' and (resid 18 through 42 )" tls = "chain 'E' and (resid 43 through 57 )" tls = "chain 'E' and (resid 58 through 59 )" tls = "chain 'F' and (resid 5 through 24 )" tls = "chain 'F' and (resid 25 through 44 )" tls = "chain 'F' and (resid 45 through 54 )" tls = "chain 'F' and (resid 55 through 57 )" tls = "chain 'I' and (resid 461 through 477 )" tls = "chain 'I' and (resid 478 through 513 )" tls = "chain 'I' and (resid 514 through 537 )" tls = "chain 'I' and (resid 538 through 560 )" tls = "chain 'I' and (resid 561 through 599 )" tls = "chain 'I' and (resid 600 through 607 )" tls = "chain 'J' and (resid 461 through 478 )" tls = "chain 'J' and (resid 479 through 504 )" tls = "chain 'J' and (resid 505 through 537 )" tls = "chain 'J' and (resid 538 through 547 )" tls = "chain 'J' and (resid 548 through 560 )" tls = "chain 'J' and (resid 561 through 585 )" tls = "chain 'J' and (resid 586 through 599 )" tls = "chain 'J' and (resid 600 through 607 )" tls = "chain 'K' and (resid 461 through 477 )" tls = "chain 'K' and (resid 478 through 491 )" tls = "chain 'K' and (resid 492 through 513 )" tls = "chain 'K' and (resid 514 through 560 )" tls = "chain 'K' and (resid 561 through 568 )" tls = "chain 'K' and (resid 569 through 599 )" tls = "chain 'K' and (resid 600 through 607 )" tls = "chain 'L' and (resid 461 through 537 )" tls = "chain 'L' and (resid 538 through 607 )" tls = "chain 'G' and (resid 8 through 32 )" tls = "chain 'G' and (resid 33 through 52 )" tls = "chain 'G' and (resid 53 through 56 )" tls = "chain 'H' and (resid 7 through 21 )" tls = "chain 'H' and (resid 22 through 46 )" tls = "chain 'H' and (resid 47 through 55 )"
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.01→40.9 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION
|