[English] 日本語
Yorodumi
- PDB-6g63: RNase E in complex with sRNA RrpA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6g63
TitleRNase E in complex with sRNA RrpA
Components
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3')
  • Ribonuclease E
KeywordsRNA BINDING PROTEIN / RNase E / small regulatory RNA
Function / homology
Function and homology information


bacterial degradosome / rRNA 5'-end processing / ribonuclease E / ribonuclease E activity / DEAD/H-box RNA helicase binding / endoribonuclease complex / 7S RNA binding / positive regulation of ATP-dependent activity / tRNA processing / RNA catabolic process ...bacterial degradosome / rRNA 5'-end processing / ribonuclease E / ribonuclease E activity / DEAD/H-box RNA helicase binding / endoribonuclease complex / 7S RNA binding / positive regulation of ATP-dependent activity / tRNA processing / RNA catabolic process / mRNA catabolic process / protein complex oligomerization / RNA processing / RNA endonuclease activity / protein homotetramerization / molecular adaptor activity / cytoplasmic side of plasma membrane / magnesium ion binding / RNA binding / zinc ion binding / membrane / identical protein binding / plasma membrane / cytoplasm
Similarity search - Function
Ribonuclease E, catalytic domain / Hypothetical Protein Ychn; Chain: A, / Polyribonucleotide phosphorylase C-terminal / Polyribonucleotide phosphorylase C terminal / : / RNase E/G, Thioredoxin-like domain / Ribonuclease E/G / Ribonuclease E / RNA-binding protein AU-1/Ribonuclease E/G / Ribonuclease E/G family ...Ribonuclease E, catalytic domain / Hypothetical Protein Ychn; Chain: A, / Polyribonucleotide phosphorylase C-terminal / Polyribonucleotide phosphorylase C terminal / : / RNase E/G, Thioredoxin-like domain / Ribonuclease E/G / Ribonuclease E / RNA-binding protein AU-1/Ribonuclease E/G / Ribonuclease E/G family / S1 domain profile. / Nucleic acid-binding proteins / Ribosomal protein S1-like RNA-binding domain / S1 RNA binding domain / S1 domain / OB fold (Dihydrolipoamide Acetyltransferase, E2P) / Nucleic acid-binding, OB-fold / Beta Barrel / 3-Layer(aba) Sandwich / Mainly Beta / Alpha Beta
Similarity search - Domain/homology
URIDINE-5'-MONOPHOSPHATE / RNA / RNA (> 10) / Ribonuclease E
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
MethodX-RAY DIFFRACTION / SYNCHROTRON / Resolution: 3.95 Å
AuthorsBandyra, K.B. / Luisi, B.F.
Funding support United Kingdom, 1items
OrganizationGrant numberCountry
Wellcome Trust200873/Z/16/Z United Kingdom
CitationJournal: Mol. Cell / Year: 2018
Title: Substrate Recognition and Autoinhibition in the Central Ribonuclease RNase E.
Authors: Bandyra, K.J. / Wandzik, J.M. / Luisi, B.F.
History
DepositionMar 31, 2018Deposition site: PDBE / Processing site: PDBE
Revision 1.0Oct 3, 2018Provider: repository / Type: Initial release
Revision 1.1Oct 10, 2018Group: Data collection / Database references / Structure summary
Category: citation / citation_author / entity
Item: _citation.journal_abbrev / _citation.journal_id_ISSN ..._citation.journal_abbrev / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.name / _entity.formula_weight
Revision 1.2Oct 31, 2018Group: Data collection / Database references / Structure summary
Category: citation / entity
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _entity.formula_weight
Revision 2.0May 8, 2024Group: Data collection / Database references ...Data collection / Database references / Derived calculations / Polymer sequence
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / entity_poly / struct_conn
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _entity_poly.pdbx_seq_one_letter_code / _struct_conn.ptnr1_auth_asym_id / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_asym_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id
Revision 3.0Dec 17, 2025Group: Advisory / Atomic model ...Advisory / Atomic model / Data collection / Derived calculations / Non-polymer description / Structure summary
Category: atom_site / atom_site_anisotrop ...atom_site / atom_site_anisotrop / chem_comp / chem_comp_atom / chem_comp_bond / pdbx_entity_nonpoly / pdbx_entry_details / pdbx_nonpoly_scheme / pdbx_unobs_or_zero_occ_atoms / struct_site
Item: _atom_site.B_iso_or_equiv / _atom_site.Cartn_x ..._atom_site.B_iso_or_equiv / _atom_site.Cartn_x / _atom_site.Cartn_y / _atom_site.Cartn_z / _atom_site.auth_atom_id / _atom_site.auth_comp_id / _atom_site.label_atom_id / _atom_site.label_comp_id / _atom_site.type_symbol / _atom_site_anisotrop.U[1][1] / _atom_site_anisotrop.U[1][2] / _atom_site_anisotrop.U[1][3] / _atom_site_anisotrop.U[2][2] / _atom_site_anisotrop.U[2][3] / _atom_site_anisotrop.U[3][3] / _atom_site_anisotrop.pdbx_auth_atom_id / _atom_site_anisotrop.pdbx_auth_comp_id / _atom_site_anisotrop.pdbx_label_atom_id / _atom_site_anisotrop.pdbx_label_comp_id / _atom_site_anisotrop.type_symbol / _chem_comp.formula / _chem_comp.formula_weight / _chem_comp.id / _chem_comp.mon_nstd_flag / _chem_comp.name / _chem_comp.type / _pdbx_entity_nonpoly.comp_id / _pdbx_nonpoly_scheme.mon_id / _pdbx_nonpoly_scheme.pdb_mon_id / _pdbx_unobs_or_zero_occ_atoms.auth_atom_id / _pdbx_unobs_or_zero_occ_atoms.auth_comp_id / _pdbx_unobs_or_zero_occ_atoms.label_atom_id / _pdbx_unobs_or_zero_occ_atoms.label_comp_id / _struct_site.details / _struct_site.pdbx_auth_comp_id

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Ribonuclease E
G: Ribonuclease E
L: Ribonuclease E
N: Ribonuclease E
B: RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)238,4958
Polymers238,0405
Non-polymers4553
Water00
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area18660 Å2
ΔGint-132 kcal/mol
Surface area102260 Å2
MethodPISA
Unit cell
Length a, b, c (Å)110.630, 110.630, 466.020
Angle α, β, γ (deg.)90.00, 90.00, 120.00
Int Tables number169
Space group name H-MP61

-
Components

#1: Protein
Ribonuclease E / RNase E


Mass: 57495.465 Da / Num. of mol.: 4 / Mutation: D303R,D346R
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (strain K12) (bacteria)
Gene: rne, ams, hmp1, b1084, JW1071 / Production host: Escherichia coli (E. coli) / References: UniProt: P21513, ribonuclease E
#2: RNA chain RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3')


Mass: 8057.715 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: Because of the low resolution, we modelled the RNA structure as two chains in a duplex of polyU:polyA. The sequence of the RNA used in the crystal is ...Details: Because of the low resolution, we modelled the RNA structure as two chains in a duplex of polyU:polyA. The sequence of the RNA used in the crystal is ACGGUUAUAAAUCAACACAUUGAUUUAUAAGCAUGGAAAUCCCCUGAGUGAAACAACGAAUUGCUGUGUGUAGUCUUUGCCCGUCUCCUACGAUGGGCUUUUUUUU
Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli (E. coli)
#3: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Zn
#4: Chemical ChemComp-U5P / URIDINE-5'-MONOPHOSPHATE


Mass: 324.181 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C9H13N2O9P
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.51 Å3/Da / Density % sol: 64.92 %
Crystal growTemperature: 293 K / Method: vapor diffusion, sitting drop / pH: 8.5
Details: 0.1 M KCl, 0.01 M MgCl2, 0.05 M Tris-HCl pH 8.5 and 30% (v/v) PEG 400

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: SOLEIL / Beamline: PROXIMA 2 / Wavelength: 0.987 Å
DetectorType: DECTRIS EIGER R 4M / Detector: PIXEL / Date: Oct 1, 2016
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.987 Å / Relative weight: 1
ReflectionResolution: 3.95→95.8 Å / Num. obs: 28217 / % possible obs: 100 % / Redundancy: 9.6 % / Rmerge(I) obs: 0.15 / Net I/σ(I): 8.3
Reflection shellResolution: 3.95→4.19 Å

-
Processing

Software
NameVersionClassification
PHENIX(1.13_2998: ???)refinement
MOSFLMdata reduction
Aimlessdata scaling
PHASERphasing
RefinementResolution: 3.95→19.947 Å / SU ML: 0.66 / Cross valid method: FREE R-VALUE / σ(F): 1.39 / Phase error: 32.82 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.2962 1371 4.92 %
Rwork0.2747 --
obs0.2757 27869 99.88 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Refinement stepCycle: LAST / Resolution: 3.95→19.947 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms15642 504 2 0 16148
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.00516451
X-RAY DIFFRACTIONf_angle_d1.01222300
X-RAY DIFFRACTIONf_dihedral_angle_d18.79410141
X-RAY DIFFRACTIONf_chiral_restr0.0542538
X-RAY DIFFRACTIONf_plane_restr0.0082847
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
3.9501-4.09010.36661470.36552647X-RAY DIFFRACTION100
4.0901-4.25230.29981520.30812634X-RAY DIFFRACTION100
4.2523-4.44380.28921350.27162643X-RAY DIFFRACTION100
4.4438-4.67530.30211320.25172629X-RAY DIFFRACTION100
4.6753-4.9640.24531290.27382661X-RAY DIFFRACTION100
4.964-5.34040.38131330.29852672X-RAY DIFFRACTION100
5.3404-5.86540.32171260.2832662X-RAY DIFFRACTION100
5.8654-6.6860.33451540.32542622X-RAY DIFFRACTION100
6.686-8.32070.34311520.30512658X-RAY DIFFRACTION100
8.3207-19.94690.22151110.2272670X-RAY DIFFRACTION99
Refinement TLS params.

Method: refined / Refine-ID: X-RAY DIFFRACTION

IDL11 (°2)L12 (°2)L13 (°2)L22 (°2)L23 (°2)L33 (°2)S11 (Å °)S12 (Å °)S13 (Å °)S21 (Å °)S22 (Å °)S23 (Å °)S31 (Å °)S32 (Å °)S33 (Å °)T11 (Å2)T12 (Å2)T13 (Å2)T22 (Å2)T23 (Å2)T33 (Å2)Origin x (Å)Origin y (Å)Origin z (Å)
11.66340.01580.3904-0.69760.58930.86681.58491.7710.62330.5390.53950.5887-1.2919-1.5827-1.20744.95030.110.3526.09170.72533.7841-42.1366-3.5297-2.2766
21.32271.636-0.93811.53220.0460.4596-0.1533-0.47051.04350.91151.1554-0.6835-2.26180.7148-0.53075.42350.59-0.08823.6951-0.01713.979116.499533.61220.0835
31.63180.4034-1.13640.94050.57382.5754-0.5726-1.8932-1.1136-1.35060.2855-0.7075-0.23682.1654-0.27573.80960.11920.07844.68170.2734.146637.866-47.4112-33.519
41.34511.36081.10021.17350.32465.3279-1.0795-0.21691.0413-1.4572-0.64620.09452.1816-0.05031.26833.9373-0.2239-0.1353.16140.05223.888422.4411-56.876431.4593
52.5248-0.39020.61293.13651.70162.5494-1.2712-0.0816-0.5912-0.32461.0872-0.00820.6999-1.9356-0.62382.53430.8272-0.63891.96530.20662.1197-19.2825-2.1493-22.6854
63.0552-0.99542.49022.63560.0263.84650.3037-0.4402-0.1908-0.75940.26950.7102-0.5869-1.4269-0.36412.00740.875-0.07791.4427-0.05681.3576-7.40933.6202-5.1581
73.127-1.19710.67622.793-1.81194.7764-0.0423-0.3856-0.3588-1.2107-0.278-0.20620.04132.6063-0.81282.55760.8985-0.34651.5959-0.88012.919211.496415.503620.5746
81.8942-0.1427-0.64754.62752.65744.93040.1442-0.04880.2714-0.51570.4897-0.6134-1.195-0.227-0.46662.54610.8306-0.31111.00350.07031.60270.44728.23622.9218
94.23340.1052-0.45668.11081.28684.20970.42770.10120.3942-0.5063-0.07541.13850.81470.4390.17963.2880.897-0.59021.5657-0.33381.514710.0246-47.2181-25.2733
101.26521.52520.56942.44531.27323.193-0.08460.0309-0.1893-0.13310.4678-0.1440.48080.1792-0.40412.00580.7614-0.36321.2532-0.19341.330120.7469-40.0418-6.905
112.0379-0.89291.85492.71291.26365.67490.30740.97540.9280.99770.6178-1.13561.26270.9573-0.71142.78621.1169-0.02062.0039-0.22731.513136.1008-32.233122.9302
123.16840.41061.96741.01611.12293.29750.3765-0.4314-0.4538-0.07880.2805-0.27460.43230.2385-0.54882.11430.6658-0.18941.1246-0.0521.317324.4986-37.88724.6067
Refinement TLS group
IDRefine-IDRefine TLS-IDSelection details
1X-RAY DIFFRACTION1chain 'A' and (resid 33 through 211 )
2X-RAY DIFFRACTION2chain 'G' and (resid 33 through 211 )
3X-RAY DIFFRACTION3chain 'L' and (resid 33 through 211 )
4X-RAY DIFFRACTION4chain 'N' and (resid 33 through 211 )
5X-RAY DIFFRACTION5chain 'A' and (resid 3 through 32 )
6X-RAY DIFFRACTION6chain 'A' and (resid 212 through 510 )
7X-RAY DIFFRACTION7chain 'G' and (resid 3 through 32 )
8X-RAY DIFFRACTION8chain 'G' and (resid 212 through 510 )
9X-RAY DIFFRACTION9chain 'L' and (resid 3 through 32 )
10X-RAY DIFFRACTION10chain 'L' and (resid 212 through 510 )
11X-RAY DIFFRACTION11chain 'N' and (resid 3 through 32 )
12X-RAY DIFFRACTION12chain 'N' and (resid 212 through 510 )

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more