[English] 日本語
Yorodumi
- PDB-1sax: Three-dimensional structure of s.aureus methicillin-resistance re... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1sax
TitleThree-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA
Components
  • 5'-d(CAAAATTACAACTGTAATATCGGAG)-3'
  • 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'
  • Methicillin resistance regulatory protein mecI
KeywordsTRANSCRIPTION/DNA / winged helix-turn-helix / TRANSCRIPTION-DNA COMPLEX
Function / homology
Function and homology information


response to antibiotic / negative regulation of DNA-templated transcription / DNA binding / DNA-templated transcription / cytoplasm
Similarity search - Function
Penicillinase repressor fold / Penicillinase repressor domain / BlaI transcriptional regulatory family / Penicillinase repressor / Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain / Arc Repressor Mutant, subunit A / Winged helix DNA-binding domain superfamily / Winged helix-like DNA-binding domain superfamily / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
: / DNA / DNA (> 10) / Methicillin resistance regulatory protein MecI / Methicillin resistance regulatory protein MecI
Similarity search - Component
Biological speciesStaphylococcus aureus subsp. aureus (bacteria)
MethodX-RAY DIFFRACTION / SYNCHROTRON / Resolution: 2.8 Å
AuthorsGarcia-Castellanos, R. / Mallorqui-Fernandez, G. / Marrero, A. / Potempa, J. / Coll, M. / Gomis-Ruth, F.X.
Citation
Journal: J.Biol.Chem. / Year: 2004
Title: On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
Authors: Garcia-Castellanos, R. / Mallorqui-Fernandez, G. / Marrero, A. / Potempa, J. / Coll, M. / Gomis-Ruth, F.X.
#1: Journal: J.Biol.Chem. / Year: 2003
Title: Three-dimensional structure of MecI. Molecular basis for transcriptional regulation of staphylococcal methicillin resistance
Authors: Garcia-Castellanos, R. / Marrero, A. / Mallorqui-Fernandez, G. / Potempa, J. / Coll, M. / Gomis-Rueth, F.X.
History
DepositionFeb 9, 2004Deposition site: RCSB / Processing site: RCSB
Revision 1.0Apr 27, 2004Provider: repository / Type: Initial release
Revision 1.1Apr 29, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Source and taxonomy / Version format compliance
Revision 1.3Aug 23, 2023Group: Data collection / Database references ...Data collection / Database references / Derived calculations / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model / struct_conn / struct_site
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr1_symmetry / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id / _struct_conn.ptnr2_symmetry / _struct_site.pdbx_auth_asym_id / _struct_site.pdbx_auth_comp_id / _struct_site.pdbx_auth_seq_id

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
C: 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'
D: 5'-d(CAAAATTACAACTGTAATATCGGAG)-3'
A: Methicillin resistance regulatory protein mecI
B: Methicillin resistance regulatory protein mecI
hetero molecules


Theoretical massNumber of molelcules
Total (without water)45,0165
Polymers44,9774
Non-polymers391
Water66737
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Unit cell
Length a, b, c (Å)133.600, 133.600, 54.700
Angle α, β, γ (deg.)90.00, 90.00, 120.00
Int Tables number152
Cell settingtrigonal
Space group name H-MP3121
Components on special symmetry positions
IDModelComponents
11B-124-

K

-
Components

#1: DNA chain 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'


Mass: 7653.955 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: MecI operator sequence
#2: DNA chain 5'-d(CAAAATTACAACTGTAATATCGGAG)-3'


Mass: 7699.025 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: MecI operator sequence
#3: Protein Methicillin resistance regulatory protein mecI / Methicillin repressor MecI / mecI


Mass: 14812.003 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Staphylococcus aureus subsp. aureus (bacteria)
Species: Staphylococcus aureus / Strain: N315 / Gene: mecI / Plasmid: pProEX Hta (Invitrogen) / Production host: Escherichia coli (E. coli) / Strain (production host): DH5alpha / References: UniProt: P68262, UniProt: P68261*PLUS
#4: Chemical ChemComp-K / POTASSIUM ION


Mass: 39.098 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: K
#5: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 37 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.1 Å3/Da / Density % sol: 60.28 %
Crystal growTemperature: 293 K / Method: vapor diffusion, hanging drop / pH: 5.5
Details: PEG 8000, magnesium chloride, pH 5.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K
Components of the solutions
IDNameCrystal-IDSol-ID
1PEG 800011
2MgCl211
3PEG 800012
4MgCl212

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: ESRF / Beamline: ID13 / Wavelength: 0.9789 Å
DetectorType: MARRESEARCH / Detector: CCD
RadiationMonochromator: liq. N2 cooled Si-111 double monochromator / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.9789 Å / Relative weight: 1
ReflectionResolution: 2.8→39.7 Å / Num. all: 14087 / Num. obs: 13777 / % possible obs: 97.8 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 0 / Redundancy: 3.5 % / Biso Wilson estimate: 86.5 Å2 / Rmerge(I) obs: 0.089 / Net I/σ(I): 19.7
Reflection shellResolution: 2.8→2.9 Å / Redundancy: 2.9 % / Rmerge(I) obs: 0.5 / Mean I/σ(I) obs: 2.3 / % possible all: 93.6

-
Processing

Software
NameVersionClassification
XDSdata scaling
XSCALEdata scaling
AMoREphasing
REFMAC5.1.24refinement
XDSdata reduction
RefinementStarting model: 1OKR
Resolution: 2.8→39.7 Å / Cor.coef. Fo:Fc: 0.947 / Cor.coef. Fo:Fc free: 0.909 / SU B: 16.874 / SU ML: 0.317 / Cross valid method: THROUGHOUT / σ(F): 0 / σ(I): 0 / ESU R: 1.501 / ESU R Free: 0.39
RfactorNum. reflection% reflectionSelection details
Rfree0.27601 898 6.5 %RANDOM
Rwork0.21199 ---
all0.21624 13775 --
obs0.21624 12877 97.81 %-
Solvent computationIon probe radii: 0.8 Å / Shrinkage radii: 0.8 Å / VDW probe radii: 1.4 Å / Solvent model: BABINET MODEL WITH MASK
Displacement parametersBiso mean: 31.56 Å2
Baniso -1Baniso -2Baniso -3
1--2.1 Å2-1.05 Å20 Å2
2---2.1 Å20 Å2
3---3.14 Å2
Refinement stepCycle: LAST / Resolution: 2.8→39.7 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms2032 1019 1 37 3089
Refine LS restraints
Refine-IDTypeDev idealDev ideal targetNumber
X-RAY DIFFRACTIONr_bond_refined_d0.0140.0223260
X-RAY DIFFRACTIONr_angle_refined_deg1.9382.3734561
X-RAY DIFFRACTIONr_dihedral_angle_1_deg5.5125238
X-RAY DIFFRACTIONr_chiral_restr0.0970.2448
X-RAY DIFFRACTIONr_gen_planes_refined0.0030.022310
X-RAY DIFFRACTIONr_nbd_refined0.2230.21457
X-RAY DIFFRACTIONr_xyhbond_nbd_refined0.1510.286
X-RAY DIFFRACTIONr_symmetry_vdw_refined0.2290.240
X-RAY DIFFRACTIONr_mcbond_it0.7651.51196
X-RAY DIFFRACTIONr_mcangle_it1.48821946
X-RAY DIFFRACTIONr_scbond_it1.61332064
X-RAY DIFFRACTIONr_scangle_it2.5394.52615
LS refinement shellResolution: 2.8→2.873 Å / Total num. of bins used: 20 /
RfactorNum. reflection
Rfree0.441 68
Rwork0.358 888

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more