[English] 日本語
Yorodumi- PDB-8a9k: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -
+Open data
-Basic information
Entry | Database: PDB / ID: 8a9k | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 with ML323 (consensus reconstruction) | |||||||||
Components |
| |||||||||
Keywords | HYDROLASE / Deubiquitinase / Complex / Enzyme-Substrate / Inhibitor | |||||||||
Function / homology | Function and homology information positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance ...positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance / brain morphogenesis / deubiquitinase activator activity / DNA repair complex / skeletal system morphogenesis / mitotic intra-S DNA damage checkpoint signaling / skin development / seminiferous tubule development / protein deubiquitination / Regulation of pyruvate metabolism / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / positive regulation of double-strand break repair via homologous recombination / homeostasis of number of cells / single fertilization / embryonic organ development / regulation of DNA repair / interstrand cross-link repair / DNA polymerase binding / response to UV / condensed chromosome / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Membrane binding and targetting of GAG proteins / Endosomal Sorting Complex Required For Transport (ESCRT) / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Negative regulation of FLT3 / Constitutive Signaling by NOTCH1 HD Domain Mutants / Regulation of FZD by ubiquitination / TICAM1,TRAF6-dependent induction of TAK1 complex / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / p75NTR recruits signalling complexes / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / PINK1-PRKN Mediated Mitophagy / TRAF6-mediated induction of TAK1 complex within TLR4 complex / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / Pexophagy / Regulation of innate immune responses to cytosolic DNA / InlA-mediated entry of Listeria monocytogenes into host cells / VLDLR internalisation and degradation / Downregulation of ERBB2:ERBB3 signaling / NF-kB is activated and signals survival / NRIF signals cell death from the nucleus / Regulation of PTEN localization / Activated NOTCH1 Transmits Signal to the Nucleus / Regulation of BACH1 activity / Translesion synthesis by REV1 / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by POLK / MAP3K8 (TPL2)-dependent MAPK1/3 activation / TICAM1, RIP1-mediated IKK complex recruitment / Downregulation of TGF-beta receptor signaling / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / Josephin domain DUBs / Regulation of activated PAK-2p34 by proteasome mediated degradation / InlB-mediated entry of Listeria monocytogenes into host cell / IKK complex recruitment mediated by RIP1 / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Autodegradation of Cdh1 by Cdh1:APC/C / TNFR1-induced NF-kappa-B signaling pathway / APC/C:Cdc20 mediated degradation of Securin / ubiquitin binding / positive regulation of protein ubiquitination / Asymmetric localization of PCP proteins / TCF dependent signaling in response to WNT / SCF-beta-TrCP mediated degradation of Emi1 / NIK-->noncanonical NF-kB signaling / skeletal system development / Ubiquitin-dependent degradation of Cyclin D / Regulation of NF-kappa B signaling / positive regulation of epithelial cell proliferation / AUF1 (hnRNP D0) binds and destabilizes mRNA / TNFR2 non-canonical NF-kB pathway / activated TAK1 mediates p38 MAPK activation Similarity search - Function | |||||||||
Biological species | Homo sapiens (human) synthetic construct (others) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.85 Å | |||||||||
Authors | Rennie, M.L. / Walden, H. | |||||||||
Funding support | European Union, United Kingdom, 2items
| |||||||||
Citation | Journal: Sci Adv / Year: 2022 Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden / Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1. | |||||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 8a9k.cif.gz | 563.5 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb8a9k.ent.gz | 437.7 KB | Display | PDB format |
PDBx/mmJSON format | 8a9k.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Summary document | 8a9k_validation.pdf.gz | 1.3 MB | Display | wwPDB validaton report |
---|---|---|---|---|
Full document | 8a9k_full_validation.pdf.gz | 1.4 MB | Display | |
Data in XML | 8a9k_validation.xml.gz | 87.3 KB | Display | |
Data in CIF | 8a9k_validation.cif.gz | 130.8 KB | Display | |
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/a9/8a9k ftp://data.pdbj.org/pub/pdb/validation_reports/a9/8a9k | HTTPS FTP |
-Related structure data
Related structure data | 14722MC 7zh3C 7zh4C 8a9jC C: citing same article (ref.) M: map data used to model this data |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
#1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9NVI1 |
---|---|
#2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9BXW9 |
-Protein , 3 types, 3 molecules CDE
#3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: P0CG48 |
---|---|
#4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: O94782, ubiquitinyl hydrolase 1 |
#5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q8TAF3 |
-DNA chain , 1 types, 2 molecules ST
#6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) |
---|
-Non-polymers , 2 types, 2 molecules
#7: Chemical | ChemComp-ZN / |
---|---|
#8: Chemical | ChemComp-JDA / |
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-Sample preparation
Component | Name: USP1(C90S)-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 with dsDNA and ML323 Type: COMPLEX / Entity ID: #1-#6 / Source: RECOMBINANT |
---|---|
Molecular weight | Experimental value: NO |
Source (natural) | Organism: Homo sapiens (human) |
Source (recombinant) | Organism: Spodoptera frugiperda (fall armyworm) |
Buffer solution | pH: 8 |
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323 |
Specimen support | Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3 |
Vitrification | Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 1000 nm |
Image recording | Electron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-Processing
Software | Name: PHENIX / Version: 1.19.2_4158: / Classification: refinement | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EM software |
| ||||||||||||||||||||||||||||
Image processing | Details: 2x binning | ||||||||||||||||||||||||||||
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||
Particle selection | Num. of particles selected: 6716868 | ||||||||||||||||||||||||||||
Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||||||
3D reconstruction | Resolution: 2.85 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 570816 / Algorithm: BACK PROJECTION / Symmetry type: POINT | ||||||||||||||||||||||||||||
Atomic model building | B value: 95.3 / Space: REAL | ||||||||||||||||||||||||||||
Refine LS restraints |
|