[English] 日本語
![](img/lk-miru.gif)
- PDB-8a9j: Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitina... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 8a9j | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Cryo-EM structure of USP1-UAF1 bound to FANCI and mono-ubiquitinated FANCD2 without ML323 (consensus reconstruction) | |||||||||
![]() |
| |||||||||
![]() | ![]() ![]() ![]() | |||||||||
Function / homology | ![]() positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / gamete generation / neuronal stem cell population maintenance ...positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / gamete generation / neuronal stem cell population maintenance / brain morphogenesis / deubiquitinase activator activity / ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() Similarity search - Function | |||||||||
Biological species | ![]() ![]() synthetic construct (others) | |||||||||
Method | ![]() ![]() ![]() | |||||||||
![]() | Rennie, M.L. / Walden, H. | |||||||||
Funding support | European Union, ![]()
| |||||||||
![]() | ![]() Title: Cryo-EM reveals a mechanism of USP1 inhibition through a cryptic binding site. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Helen Walden / ![]() Abstract: Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple ...Repair of DNA damage is critical to genomic integrity and frequently disrupted in cancers. Ubiquitin-specific protease 1 (USP1), a nucleus-localized deubiquitinase, lies at the interface of multiple DNA repair pathways and is a promising drug target for certain cancers. Although multiple inhibitors of this enzyme, including one in phase 1 clinical trials, have been established, their binding mode is unknown. Here, we use cryo-electron microscopy to study an assembled enzyme-substrate-inhibitor complex of USP1 and the well-established inhibitor, ML323. Achieving 2.5-Å resolution, with and without ML323, we find an unusual binding mode in which the inhibitor disrupts part of the hydrophobic core of USP1. The consequent conformational changes in the secondary structure lead to subtle rearrangements in the active site that underlie the mechanism of inhibition. These structures provide a platform for structure-based drug design targeting USP1. | |||||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 569.3 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 443.7 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Arichive directory | ![]() ![]() | HTTPS FTP |
---|
-Related structure data
Related structure data | ![]() 15284MC ![]() 7zh3C ![]() 7zh4C ![]() 8a9kC C: citing same article ( M: map data used to model this data |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
#1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() |
---|---|
#2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: Ubiquitin conjugated to K561 / Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() |
-Protein , 3 types, 3 molecules CDE
#3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() |
---|---|
#4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() ![]() |
#5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() |
-DNA chain / Non-polymers , 2 types, 3 molecules ST![](data/chem/img/ZN.gif)
![](data/chem/img/ZN.gif)
#6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Actual sequence: TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) #7: Chemical | ChemComp-ZN / | |
---|
-Details
Has ligand of interest | N |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: ![]() |
-
Sample preparation
Component |
| ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source (natural) | Organism: ![]() ![]() | ||||||||||||||||||
Source (recombinant) | Organism: ![]() ![]() ![]() | ||||||||||||||||||
Buffer solution | pH: 8 | ||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied![]() ![]() Details: 9.3 uM USP1-UAF1, 1.8 uM FANCI-FANCD2Ub, 2.2 uM dsDNA (61 base-pairs), 18 uM ML323 | ||||||||||||||||||
Vitrification![]() | Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K / Details: blotted for 3.0 secs before plunging |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source![]() ![]() |
Electron lens | Mode: BRIGHT FIELD![]() |
Image recording | Electron dose: 40 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
Software | Name: PHENIX / Version: 1.19.2_4158: / Classification: refinement | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EM software |
| ||||||||||||||||||||||||||||
Image processing | Details: 2x binning | ||||||||||||||||||||||||||||
CTF correction![]() | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||
Particle selection | Num. of particles selected: 6716868 | ||||||||||||||||||||||||||||
Symmetry | Point symmetry![]() | ||||||||||||||||||||||||||||
3D reconstruction![]() | Resolution: 2.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 583484 / Symmetry type: POINT | ||||||||||||||||||||||||||||
Atomic model building | B value: 94.9 / Space: REAL | ||||||||||||||||||||||||||||
Atomic model building |
| ||||||||||||||||||||||||||||
Refine LS restraints |
|