- EMDB-11934: Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2... -
+
Open data
ID or keywords:
Loading...
-
Basic information
Entry
Database: EMDB / ID: EMD-11934
Title
Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2, and FANCI
Map data
Globally sharpened map
Sample
Complex: Enzyme substrate complex of USP1-UAF1 and FANCI-FANCD2ub-dsDNA
Complex: Enzyme substrate complex of USP1-UAF1 and FANCI-FANCD2ub
Protein or peptide: Fanconi anemia group I protein
Protein or peptide: Fanconi anemia group D2 protein
Protein or peptide: Ubiquitin-60S ribosomal protein L40
Protein or peptide: Ubiquitin carboxyl-terminal hydrolase 1
Protein or peptide: WD repeat-containing protein 48
Complex: DNA
DNA: DNA (61-MER)
Ligand: ZINC ION
Function / homology
Function and homology information
positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance ...positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance / brain morphogenesis / deubiquitinase activator activity / DNA repair complex / skeletal system morphogenesis / mitotic intra-S DNA damage checkpoint signaling / skin development / seminiferous tubule development / protein deubiquitination / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / Eukaryotic Translation Termination / Response of EIF2AK4 (GCN2) to amino acid deficiency / SRP-dependent cotranslational protein targeting to membrane / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / Viral mRNA Translation / positive regulation of double-strand break repair via homologous recombination / homeostasis of number of cells / L13a-mediated translational silencing of Ceruloplasmin expression / GTP hydrolysis and joining of the 60S ribosomal subunit / single fertilization / Major pathway of rRNA processing in the nucleolus and cytosol / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / embryonic organ development / regulation of DNA repair / interstrand cross-link repair / cytosolic ribosome / DNA polymerase binding / response to UV / condensed chromosome / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Membrane binding and targetting of GAG proteins / Endosomal Sorting Complex Required For Transport (ESCRT) / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Negative regulation of FLT3 / Constitutive Signaling by NOTCH1 HD Domain Mutants / Regulation of FZD by ubiquitination / TICAM1,TRAF6-dependent induction of TAK1 complex / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / p75NTR recruits signalling complexes / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / PINK1-PRKN Mediated Mitophagy / TRAF6-mediated induction of TAK1 complex within TLR4 complex / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / Pexophagy / Regulation of innate immune responses to cytosolic DNA / InlA-mediated entry of Listeria monocytogenes into host cells / VLDLR internalisation and degradation / Downregulation of ERBB2:ERBB3 signaling / NF-kB is activated and signals survival / NRIF signals cell death from the nucleus / Regulation of PTEN localization / Activated NOTCH1 Transmits Signal to the Nucleus / Regulation of BACH1 activity / Translesion synthesis by REV1 / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by POLK / MAP3K8 (TPL2)-dependent MAPK1/3 activation / TICAM1, RIP1-mediated IKK complex recruitment / Downregulation of TGF-beta receptor signaling / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / Josephin domain DUBs / Regulation of activated PAK-2p34 by proteasome mediated degradation / InlB-mediated entry of Listeria monocytogenes into host cell / IKK complex recruitment mediated by RIP1 / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Autodegradation of Cdh1 by Cdh1:APC/C / TNFR1-induced NF-kappa-B signaling pathway / APC/C:Cdc20 mediated degradation of Securin / ubiquitin binding / positive regulation of protein ubiquitination / Asymmetric localization of PCP proteins Similarity search - Function
Ubiquitin specific peptidase 1 / WDR48/Bun107 / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain ...Ubiquitin specific peptidase 1 / WDR48/Bun107 / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 / FANCI solenoid 2 / FANCI solenoid 3 / FANCI solenoid 4 / FANCI helical domain 1 / FANCI helical domain 2 / Fanconi anaemia protein FANCD2 / Fanconi anaemia protein FancD2 nuclease / Ubiquitin specific protease (USP) domain signature 2. / Ubiquitin specific protease (USP) domain signature 1. / Ubiquitin specific protease, conserved site / Peptidase C19, ubiquitin carboxyl-terminal hydrolase / Ubiquitin carboxyl-terminal hydrolase / Ubiquitin specific protease domain / Ubiquitin specific protease (USP) domain profile. / Ribosomal L40e family / Ribosomal_L40e / Ribosomal protein L40e / Ribosomal protein L40e superfamily / Papain-like cysteine peptidase superfamily / Ubiquitin domain signature. / Ubiquitin conserved site / Ubiquitin domain / Ubiquitin family / Ubiquitin homologues / Ubiquitin domain profile. / Ubiquitin-like domain / G-protein beta WD-40 repeat / Ubiquitin-like domain superfamily / WD40 repeat, conserved site / Trp-Asp (WD) repeats signature. / Trp-Asp (WD) repeats profile. / Trp-Asp (WD) repeats circular profile. / WD domain, G-beta repeat / WD40 repeats / WD40 repeat / WD40-repeat-containing domain superfamily / WD40/YVTN repeat-like-containing domain superfamily Similarity search - Domain/homology
Ubiquitin carboxyl-terminal hydrolase 1 / Ubiquitin-ribosomal protein eL40 fusion protein / WD repeat-containing protein 48 / Fanconi anemia group D2 protein / Fanconi anemia group I protein Similarity search - Component
Biological species
Homo sapiens (human) / synthetic construct (others)
Method
single particle reconstruction / cryo EM / Resolution: 3.7 Å
Journal: Nat Struct Mol Biol / Year: 2021 Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Rachel Toth / Helen Walden / Abstract: Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the ...Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the monoubiquitinated FANCI-FANCD2 heterodimer, which is involved in the repair of DNA interstrand crosslinks via the Fanconi anemia pathway. Here we determine structures of human USP1-UAF1 with and without ubiquitin and bound to monoubiquitinated FANCI-FANCD2. The crystal structures of USP1-UAF1 reveal plasticity in USP1 and key differences to USP12-UAF1 and USP46-UAF1, two related proteases. A cryo-EM reconstruction of USP1-UAF1 in complex with monoubiquitinated FANCI-FANCD2 highlights a highly orchestrated deubiquitination process, with USP1-UAF1 driving conformational changes in the substrate. An extensive interface between UAF1 and FANCI, confirmed by mutagenesis and biochemical assays, provides a molecular explanation for the requirement of both proteins, despite neither being directly involved in catalysis. Overall, our data provide molecular details of USP1-UAF1 regulation and substrate recognition.
Name: DNA (61-MER) / type: dna / ID: 6 Details: Arbitrary DNA sequence modelled due to insufficient local resolution to determine sequence register. DNA used TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Number of copies: 2 / Classification: DNA
Name: ZINC ION / type: ligand / ID: 7 / Number of copies: 1 / Formula: ZN
Molecular weight
Theoretical: 65.409 Da
-
Experimental details
-
Structure determination
Method
cryo EM
Processing
single particle reconstruction
Aggregation state
particle
-
Sample preparation
Concentration
4.3 mg/mL
Buffer
pH: 8 Component:
Concentration
Formula
Name
20.0 mM
C4H11NO3
Tris
150.0 mM
NaCl
NaCl
2.0 mM
C4H10O2S2
DTT
Vitrification
Cryogen name: ETHANE / Chamber humidity: 95 % / Chamber temperature: 288 K / Instrument: FEI VITROBOT MARK IV
-
Electron microscopy
Microscope
JEOL CRYO ARM 300
Image recording
Film or detector model: DIRECT ELECTRON DE-64 (8k x 8k) / Detector mode: COUNTING / Average exposure time: 14.9 sec. / Average electron dose: 65.0 e/Å2
Electron beam
Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
Electron optics
Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD
+
Image processing
Particle selection
Number selected: 249732
CTF correction
Software - Name: cryoSPARC (ver. 2.13.2)
Startup model
Type of model: NONE / Details: Ab initio reconstruction in cryosparc
Final reconstruction
Applied symmetry - Point group: C1 (asymmetric) / Resolution.type: BY AUTHOR / Resolution: 3.7 Å / Resolution method: FSC 0.143 CUT-OFF / Software - Name: cryoSPARC (ver. 2.13.2) / Number images used: 391552
Initial angle assignment
Type: MAXIMUM LIKELIHOOD
Final angle assignment
Type: MAXIMUM LIKELIHOOD
FSC plot (resolution estimation)
+
About Yorodumi
-
News
-
Feb 9, 2022. New format data for meta-information of EMDB entries
New format data for meta-information of EMDB entries
Version 3 of the EMDB header file is now the official format.
The previous official version 1.9 will be removed from the archive.
In the structure databanks used in Yorodumi, some data are registered as the other names, "COVID-19 virus" and "2019-nCoV". Here are the details of the virus and the list of structure data.
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)
EMDB accession codes are about to change! (news from PDBe EMDB page)
The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
The EM Navigator/Yorodumi systems omit the EMD- prefix.
Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator
Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.
Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi