PDB Search results for query - Protein Data Bank Japan

PDB: 2 results

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Descriptor:	sNRE26
Authors:	Finger, L.D, Trantirek, L, Johansson, C, Feigon, J.
Deposit date:	2003-09-01
Release date:	2003-11-25
Last modified:	2024-05-01
Method:	SOLUTION NMR
Cite:	Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin Nucleic Acids Res., 31, 2003

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Descriptor:	18S ribosomal RNA, 5'ETS
Authors:	Finger, L.D, Trantirek, L, Johansson, C, Feigon, J.
Deposit date:	2003-09-01
Release date:	2003-11-25
Last modified:	2024-05-01
Method:	SOLUTION NMR
Cite:	Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003