7U0I
 
 | | Structure of LIN28b nucleosome bound 2 OCT4 | | Descriptor: | DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Tengfei, L, Guan, R, Bai, Y. | | Deposit date: | 2022-02-18 | | Release date: | 2023-06-28 | | Method: | ELECTRON MICROSCOPY (2.6 Å) | | Cite: | Structural mechanism of LIN28B nucleosome targeting by OCT4.
Mol.Cell, 83, 2023
|
|
7U0G
 | | structure of LIN28b nucleosome bound 3 OCT4 | | Descriptor: | DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Lian, T, Guan, R, Bai, Y. | | Deposit date: | 2022-02-18 | | Release date: | 2023-06-28 | | Method: | ELECTRON MICROSCOPY (2.6 Å) | | Cite: | Structural mechanism of LIN28B nucleosome targeting by OCT4.
Mol.Cell, 83, 2023
|
|
6Y35
 | | CCAAT-binding complex from Aspergillus fumigatus with cycA DNA | | Descriptor: | CCAAT-binding factor complex subunit HapC, CCAAT-binding factor complex subunit HapE, CCAAT-binding transcription factor subunit HAPB, ... | | Authors: | Groll, M, Huber, E.M. | | Deposit date: | 2020-02-17 | | Release date: | 2020-05-27 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of HapE P88L -linked antifungal triazole resistance in Aspergillus fumigatus .
Life Sci Alliance, 3, 2020
|
|
6V2K
 | | The nucleosome structure after H2A-H2B exchange | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A, ... | | Authors: | Arimura, Y, Hirano, R, Kurumizaka, H. | | Deposit date: | 2019-11-24 | | Release date: | 2020-11-25 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Histone variant H2A.B-H2B dimers are spontaneously exchanged with canonical H2A-H2B in the nucleosome.
Commun Biol, 4, 2021
|
|
3REK
 | |
4WU9
 | | Structure of cisPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
4H9S
 | | Complex structure 6 of DAXX/H3.3(sub7)/H4 | | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | | Deposit date: | 2012-09-24 | | Release date: | 2012-10-17 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out
To be Published
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
2YFW
 | |
6A7U
 | | Crystal structure of histone H2A.Bbd-H2B dimer | | Descriptor: | Histone H2B type 2-E,Histone H2A-Bbd type 2/3 | | Authors: | Dai, L, Zhou, Z. | | Deposit date: | 2018-07-04 | | Release date: | 2019-02-27 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of the histone heterodimer containing histone variant H2A.Bbd.
Biochem. Biophys. Res. Commun., 503, 2018
|
|
3R45
 | | Structure of a CENP-A-Histone H4 Heterodimer in complex with chaperone HJURP | | Descriptor: | GLYCEROL, Histone H3-like centromeric protein A, Histone H4, ... | | Authors: | Hu, H, Liu, Y, Wang, M, Fang, J, Huang, H, Yang, N, Li, Y, Wang, J, Yao, X, Shi, Y, Li, G, Xu, R.M. | | Deposit date: | 2011-03-17 | | Release date: | 2011-04-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structure of a CENP-A-histone H4 heterodimer in complex with chaperone HJURP
Genes Dev., 25, 2011
|
|
5B2J
 | | Human nucleosome containing CpG methylated DNA | | Descriptor: | DNA (146-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Fujii, Y, Wakamori, M, Umehara, T, Yokoyama, S. | | Deposit date: | 2016-01-18 | | Release date: | 2016-06-15 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation.
Febs Open Bio, 6, 2016
|
|
8Q36
 | | Structure of Nucleosome Core with a Bound Metallopeptide Conjugate (Foamy Virus GAG Peptide-Au[I] Compound) | | Descriptor: | DNA (145-MER), GAG structural protein, Histone H2A type 1-B/E, ... | | Authors: | De Falco, L, Batchelor, L.K, Dyson, P.J, Davey, C.A. | | Deposit date: | 2023-08-03 | | Release date: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.604 Å) | | Cite: | Viral peptide conjugates for metal-warhead delivery to chromatin.
Rsc Adv, 14, 2024
|
|
4NFT
 | | Crystal structure of human lnkH2B-h2A.Z-Anp32e | | Descriptor: | Acidic leucine-rich nuclear phosphoprotein 32 family member E, Histone H2B type 2-E, Histone H2A.Z | | Authors: | Shan, S, Pan, L, Mao, Z, Wang, W, Sun, J, Dong, Q, Liang, X, Ding, X, Chen, S, Dai, L, Zhang, Z, Zhu, B, Zhou, Z. | | Deposit date: | 2013-11-01 | | Release date: | 2014-04-09 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.61 Å) | | Cite: | Anp32e, a higher eukaryotic histone chaperone directs preferential recognition for H2A.Z
Cell Res., 24, 2014
|
|
8UQC
 | | Crystal structure of RNF168 (RING)-UbcH5c fused to H2A-H2B via a 20-residue linker (crystallization condition 2) | | Descriptor: | E3 ubiquitin-protein ligase RNF168,Ubiquitin-conjugating enzyme E2 D3,Histone H2B type 2-E,Histone H2A type 1-B/E, ZINC ION | | Authors: | Hu, Q, Botuyan, M.V, Mer, G. | | Deposit date: | 2023-10-23 | | Release date: | 2024-01-17 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.61 Å) | | Cite: | Mechanisms of RNF168 nucleosome recognition and ubiquitylation.
Mol.Cell, 84, 2024
|
|
5BT1
 | | histone chaperone Hif1 playing with histone H2A-H2B dimer | | Descriptor: | HAT1-interacting factor 1, Histone H2A.1, Histone H2B.1 | | Authors: | Liu, H, Zhang, M, Gao, Y, Teng, M, Niu, L. | | Deposit date: | 2015-06-02 | | Release date: | 2016-10-26 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.62 Å) | | Cite: | Structural Insights into the Association of Hif1 with Histones H2A-H2B Dimer and H3-H4 Tetramer
Structure, 24, 2016
|
|
5XF6
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
5F99
 | |
6E0C
 | |
5CPK
 | | Nucleosome containing methylated Sat2L DNA | | Descriptor: | DNA (145-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Osakabe, A, Arimura, Y, Adachi, F, Maehara, K, Ohkawa, Y, Kurumizaka, H. | | Deposit date: | 2015-07-21 | | Release date: | 2015-10-28 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.632 Å) | | Cite: | Influence of DNA methylation on positioning and DNA flexibility of nucleosomes with pericentric satellite DNA.
Open Biology, 5, 2015
|
|
8EVI
 | | CX3CR1 nucleosome and PU.1 complex containing disulfide bond mutations | | Descriptor: | DNA (167-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Lian, T, Guan, R, Bai, Y. | | Deposit date: | 2022-10-20 | | Release date: | 2023-11-01 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (2.64 Å) | | Cite: | Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha.
Nat.Struct.Mol.Biol., 31, 2024
|
|
8JL9
 | | Cryo-EM structure of the human nucleosome with scFv | | Descriptor: | DNA (193-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Oishi, T, Hatazawa, S, Kujirai, T, Kato, J, Kobayashi, Y, Ogasawara, M, Akatsu, M, Takizawa, Y, Kurumizaka, H. | | Deposit date: | 2023-06-02 | | Release date: | 2023-10-04 | | Last modified: | 2023-11-08 | | Method: | ELECTRON MICROSCOPY (2.65 Å) | | Cite: | Contributions of histone tail clipping and acetylation in nucleosome transcription by RNA polymerase II.
Nucleic Acids Res., 51, 2023
|
|
3MGQ
 | | Binding of Nickel ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
2NZD
 | | Nucleosome core particle containing 145 bp of DNA | | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | | Deposit date: | 2006-11-23 | | Release date: | 2007-04-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | DNA stretching and extreme kinking in the nucleosome core
J.Mol.Biol., 368, 2007
|
|
3REI
 | |
