2YPF
| Structure of the AvrBs3-DNA complex provides new insights into the initial thymine-recognition mechanism | Descriptor: | 5'-D(*TP*AP*GP*AP*GP*GP*GP*TP*TP*AP*GP*GP*TP*TP *TP*AP*TP*AP*TP*AP*AP)-3', 5'-D(*TP*TP*TP*AP*TP*AP*TP*AP*AP*AP*CP*CP*TP*AP *AP*CP*CP*CP*TP*CP*TP*AP)-3', AVRBS3 | Authors: | Stella, S, Molina, R, Yefimenko, I, Prieto, J, Silva, G.H, Bertonati, C, Juillerat, A, Duchateau, P, Montoya, G. | Deposit date: | 2012-10-30 | Release date: | 2013-08-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.55 Å) | Cite: | Structure of the Avrbs3-DNA Complex Provides New Insights Into the Initial Thymine-Recognition Mechanism Acta Crystallogr.,Sect.D, 69, 2013
|
|
4CJ9
| BurrH DNA-binding protein from Burkholderia rhizoxinica in its apo form | Descriptor: | BURRH, SELENIUM ATOM | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | Deposit date: | 2013-12-19 | Release date: | 2014-07-09 | Last modified: | 2014-07-23 | Method: | X-RAY DIFFRACTION (2.214 Å) | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification Acta Crystallogr.,Sect.D, 70, 2014
|
|
4CJA
| BurrH DNA-binding protein from Burkholderia rhizoxinica in complex with its target DNA | Descriptor: | 5'-D(*DTP*AP*TP*AP*AP*CP*GP*TP*AP*TP*TP*TP*GP*CP *TP*TP*CP*TP*CP*TP*TP*AP*AP)-3', 5'-D(*DTP*TP*AP*AP*GP*AP*GP*AP*AP*GP*CP*AP*AP*DP *TP*AP*CP*GP*TP*TP*AP*TP*AP)-3', BURRH | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | Deposit date: | 2013-12-19 | Release date: | 2014-07-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.651 Å) | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification Acta Crystallogr.,Sect.D, 70, 2014
|
|
3IV5
| |
3JR9
| |
3JRF
| |
3JRD
| |
3JRB
| |
3JRH
| |
3JRA
| |
3JRG
| |
3JRC
| |
3JRI
| |
3JRE
| |
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
6R9R
| Crystal structure of Csx1 in complex with cyclic oligoadenylate cOA4 conformation 2 | Descriptor: | CRISPR-associated (Cas) DxTHG family, circular RNA (5'-R(P*AP*AP*AP*A)-3') | Authors: | Molina, R, Montoya, G, Sofos, N, Stella, S. | Deposit date: | 2019-04-03 | Release date: | 2019-10-02 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas. Nat Commun, 10, 2019
|
|
6R7B
| Crystal structure of Csx1 in complex with cyclic oligoadenylate cOA4 conformation 1 | Descriptor: | CRISPR-associated (Cas) DxTHG family, RNA (5'-R(P*AP*AP*AP*A)-3') | Authors: | Molina, R, Montoya, G, Sofos, N, Stella, S. | Deposit date: | 2019-03-28 | Release date: | 2019-10-02 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3.12 Å) | Cite: | Structure of Csx1-cOA4complex reveals the basis of RNA decay in Type III-B CRISPR-Cas. Nat Commun, 10, 2019
|
|
4UT0
| THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MN (STATE 7) | Descriptor: | 5'-D(*CP*CP*GP*GP*CP*AP*AP*GP*GP*CP)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*CP)-3', 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*AP)-3', ... | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | Deposit date: | 2014-07-17 | Release date: | 2014-12-17 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease. Nat.Struct.Mol.Biol., 22, 2015
|
|
7Z56
| Crystal Structure of the Ring Nuclease 0455 from Sulfolobus islandicus (Sis0455) in its apo form | Descriptor: | CRISPR-associated protein | Authors: | Molina, R, Martin-Garcia, R, Lopez-Mendez, B, Jensen, A.L.G, Marchena-Hurtado, J, Stella, S, Montoya, G. | Deposit date: | 2022-03-08 | Release date: | 2022-11-23 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.27 Å) | Cite: | Molecular basis of cyclic tetra-oligoadenylate processing by small standalone CRISPR-Cas ring nucleases. Nucleic Acids Res., 50, 2022
|
|
7Z55
| Crystal Structure of the Ring Nuclease 0455 from Sulfolobus islandicus (Sis0455) in complex with its substrate | Descriptor: | ACETATE ION, CRISPR-associated protein, Cyclic RNA cA4, ... | Authors: | Molina, R, Martin-Garcia, R, Lopez-Mendez, B, Jensen, A.L.G, Marchena-Hurtado, J, Stella, S, Montoya, G. | Deposit date: | 2022-03-08 | Release date: | 2022-11-23 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.664 Å) | Cite: | Molecular basis of cyclic tetra-oligoadenylate processing by small standalone CRISPR-Cas ring nucleases. Nucleic Acids Res., 50, 2022
|
|
7ODF
| Structure of the mini-RNA-guided endonuclease CRISPR-Cas_phi3 | Descriptor: | Cas_phi3, DNA (5'-D(P*GP*G)-3'), DNA (5'-D(P*GP*TP*AP*AP*TP*TP*CP*AP*G)-3'), ... | Authors: | Carabias del Rey, A, Fugilsang, A, Temperini, P, Pape, T, Sofos, N, Stella, S, Erledsson, S, Montoya, G. | Deposit date: | 2021-04-29 | Release date: | 2021-07-21 | Last modified: | 2021-08-11 | Method: | ELECTRON MICROSCOPY (2.7 Å) | Cite: | Structure of the mini-RNA-guided endonuclease CRISPR-Cas12j3. Nat Commun, 12, 2021
|
|
5MGA
| |
6QZQ
| |
6QZT
| |
7PQ6
| Crystal Structure of the Ring Nuclease 0811 mutant-S12A from Sulfolobus islandicus (Sis0811) | Descriptor: | CRISPR-associated protein, APE2256 family | Authors: | Molina, R, Jensen, A.L.G, Marchena-Hurtado, J, Lopez-Mendez, B, Stella, S, Montoya, G. | Deposit date: | 2021-09-16 | Release date: | 2021-11-24 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.67 Å) | Cite: | Structural basis of cyclic oligoadenylate degradation by ancillary Type III CRISPR-Cas ring nucleases. Nucleic Acids Res., 49, 2021
|
|