1QWB
| |
1QWA
| NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
5FV7
| Human Fen1 in complex with an N-hydroxyurea compound | Descriptor: | 1-[(2S)-2,3-dihydro-1,4-benzodioxin-2-ylmethyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione, FLAP ENDONUCLEASE 1, MAGNESIUM ION | Authors: | Exell, J.C, Thompson, M.J, Finger, L.D, Shaw, S.K, Abbott, W.M, McWhirter, C, Debreczeni, J.E, Jones, C.D, Nissink, J.W.M, Ward, T.A, Sioberg, C.W.L, Molina, D.M, Durant, S.T, Grasby, J.A. | Deposit date: | 2016-02-03 | Release date: | 2016-08-17 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Cellular Active N-Hydroxyurea Fen1 Inhibitors Block Substrate Entry to the Active Site Nat.Chem.Biol., 12, 2016
|
|
1Q75
| |
1IE2
| Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | Deposit date: | 2001-04-05 | Release date: | 2001-06-20 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin. J.Mol.Biol., 309, 2001
|
|
1IE1
| NMR Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by Hamster Nucleolin RBD12. | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | Deposit date: | 2001-04-05 | Release date: | 2001-06-20 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin. J.Mol.Biol., 309, 2001
|
|
1NA2
| |
1RKJ
| Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | Descriptor: | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3', Nucleolin | Authors: | Johansson, C, Finger, L.D, Trantirek, L, Mueller, T.D, Kim, S, Laird-Offringa, I.A, Feigon, J. | Deposit date: | 2003-11-21 | Release date: | 2004-04-27 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target. J.Mol.Biol., 337, 2004
|
|
5K97
| Flap endonuclease 1 (FEN1) D233N with cleaved product fragment and Sm3+ | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | Deposit date: | 2016-05-31 | Release date: | 2017-06-28 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.102 Å) | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability. Nat Commun, 8, 2017
|
|
5KSE
| Flap endonuclease 1 (FEN1) R100A with 5'-flap substrate DNA and Sm3+ | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*AP*AP*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | Deposit date: | 2016-07-08 | Release date: | 2017-06-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.105 Å) | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability. Nat Commun, 8, 2017
|
|
3Q8K
| Crystal Structure of Human Flap Endonuclease FEN1 (WT) in complex with product 5'-flap DNA, SM3+, and K+ | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | Deposit date: | 2011-01-06 | Release date: | 2011-04-27 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.2001 Å) | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily. Cell(Cambridge,Mass.), 145, 2011
|
|
3Q8M
| Crystal Structure of Human Flap Endonuclease FEN1 (D181A) in complex with substrate 5'-flap DNA and K+ | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | Deposit date: | 2011-01-06 | Release date: | 2011-04-27 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily. Cell(Cambridge,Mass.), 145, 2011
|
|
3Q8L
| Crystal Structure of Human Flap Endonuclease FEN1 (WT) in complex with substrate 5'-flap DNA, SM3+, and K+ | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Classen, S, Chapados, B.R, Arvai, A, Finger, D.L, Guenther, G, Tomlinson, C.G, Thompson, P, Sarker, A.H, Shen, B, Cooper, P.K, Grasby, J.A, Tainer, J.A. | Deposit date: | 2011-01-06 | Release date: | 2011-04-27 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.319 Å) | Cite: | Human Flap Endonuclease Structures, DNA Double-Base Flipping, and a Unified Understanding of the FEN1 Superfamily. Cell(Cambridge,Mass.), 145, 2011
|
|
1YMO
| |
5UM9
| Flap endonuclease 1 (FEN1) D86N with 5'-flap substrate DNA and Sm3+ | Descriptor: | DNA (5'-D(*AP*CP*CP*GP*TP*CP*C)-3'), DNA (5'-D(*AP*CP*TP*CP*TP*GP*CP*CP*TP*CP*AP*AP*GP*AP*CP*GP*GP*T)-3'), DNA (5'-D(P*TP*CP*TP*TP*GP*AP*GP*GP*CP*AP*GP*AP*GP*T)-3'), ... | Authors: | Tsutakawa, S.E, Arvai, A.S, Tainer, J.A. | Deposit date: | 2017-01-26 | Release date: | 2017-06-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.805 Å) | Cite: | Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability. Nat Commun, 8, 2017
|
|