4G92
 
 | | CCAAT-binding complex from Aspergillus nidulans with DNA | | Descriptor: | DNA, HAPB protein, HapE, ... | | Authors: | Huber, E.M, Scharf, D.H, Hortschansky, P, Groll, M, Brakhage, A.A. | | Deposit date: | 2012-07-23 | | Release date: | 2012-10-31 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | DNA Minor Groove Sensing and Widening by the CCAAT-Binding Complex.
Structure, 20, 2012
|
|
4EO5
 | | Yeast Asf1 bound to H3/H4G94P mutant | | Descriptor: | ACETATE ION, GLYCEROL, Histone H3.2, ... | | Authors: | Scorgie, J.K, Churchill, M.E. | | Deposit date: | 2012-04-13 | | Release date: | 2012-06-13 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | The conformational flexibility of the C-terminus of histone H4 promotes histone octamer and nucleosome stability and yeast viability.
Epigenetics Chromatin, 5, 2012
|
|
4H9O
 | | Complex structure 2 of DAXX/H3.3(sub5,G90M)/H4 | | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | | Deposit date: | 2012-09-24 | | Release date: | 2012-10-10 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.053 Å) | | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out
To be Published
|
|
4H9R
 | | Complex structure 5 of DAXX(E225A)/H3.3(sub5,G90A)/H4 | | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | | Deposit date: | 2012-09-24 | | Release date: | 2012-10-17 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.197 Å) | | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out
To be Published
|
|
4H9Q
 | | Complex structure 4 of DAXX(E225A)/H3.3(sub5)/H4 | | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | | Authors: | Elsasser, S.J, Huang, H, Lewis, P.W, Chin, J.W, Allis, D.C, Patel, D.J. | | Deposit date: | 2012-09-24 | | Release date: | 2012-10-17 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | DAXX chaperone envelops an H3.3/H4 dimer dictating H3.3-specific read out
To be Published
|
|
4HGA
 | | Structure of the variant histone H3.3-H4 heterodimer in complex with its chaperone DAXX | | Descriptor: | Death domain-associated protein 6, Histone H3.3, Histone H4, ... | | Authors: | Liu, C.P, Xiong, C.Y, Wang, M.Z, Yu, Z.L, Yang, N, Chen, P, Zhang, Z.G, Li, G.H, Xu, R.M. | | Deposit date: | 2012-10-07 | | Release date: | 2012-11-07 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.799 Å) | | Cite: | Structure of the variant histone H3.3-H4 heterodimer in complex with its chaperone DAXX.
Nat.Struct.Mol.Biol., 19, 2012
|
|
1HIO
 | | HISTONE OCTAMER (CHICKEN), CHROMOSOMAL PROTEIN, ALPHA CARBONS ONLY | | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | | Authors: | Arents, G, Moudrianakis, E.N. | | Deposit date: | 1991-09-19 | | Release date: | 1998-11-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix.
Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
5MLU
 | | Crystal structure of the PFV GAG CBS bound to a mononucleosome | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B, ... | | Authors: | Pye, V.E, Maskell, D.P, Lesbats, P, Cherepanov, P. | | Deposit date: | 2016-12-07 | | Release date: | 2017-05-10 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural basis for spumavirus GAG tethering to chromatin.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
6Y35
 | | CCAAT-binding complex from Aspergillus fumigatus with cycA DNA | | Descriptor: | CCAAT-binding factor complex subunit HapC, CCAAT-binding factor complex subunit HapE, CCAAT-binding transcription factor subunit HAPB, ... | | Authors: | Groll, M, Huber, E.M. | | Deposit date: | 2020-02-17 | | Release date: | 2020-05-27 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of HapE P88L -linked antifungal triazole resistance in Aspergillus fumigatus .
Life Sci Alliance, 3, 2020
|
|
6Y5D
 | | Structure of human cGAS (K394E) bound to the nucleosome | | Descriptor: | Cyclic GMP-AMP synthase, DNA (153-MER), Histone H2A type 2-A, ... | | Authors: | Pathare, G.R, Cavadini, S, Kempf, G, Thoma, N.H. | | Deposit date: | 2020-02-25 | | Release date: | 2020-09-23 | | Last modified: | 2020-12-09 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural mechanism of cGAS inhibition by the nucleosome.
Nature, 587, 2020
|
|
6YN1
 | | Crystal structure of histone chaperone APLF acidic domain bound to the histone H2A-H2B-H3-H4 octamer | | Descriptor: | Aprataxin and PNK-like factor, CHLORIDE ION, GLYCEROL, ... | | Authors: | Corbeski, I, Guo, X, Van Ingen, H, Sixma, T.K. | | Deposit date: | 2020-04-10 | | Release date: | 2021-11-17 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Chaperoning of the histone octamer by the acidic domain of DNA repair factor APLF.
Sci Adv, 8, 2022
|
|
6ZHX
 | | Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: nucleosome class. | | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (145-MER) Widom 601 sequence, Histone H2A type 1, ... | | Authors: | Bacic, L, Gaullier, G, Croll, T.I, Deindl, S. | | Deposit date: | 2020-06-24 | | Release date: | 2020-12-23 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (2.5 Å) | | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch.
Cell Rep, 33, 2020
|
|
5O9G
 | | Structure of nucleosome-Chd1 complex | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Chromo domain-containing protein 1, ... | | Authors: | Farnung, L, Vos, S.M, Wigge, C, Cramer, P. | | Deposit date: | 2017-06-19 | | Release date: | 2017-10-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | Nucleosome-Chd1 structure and implications for chromatin remodelling.
Nature, 550, 2017
|
|
6Z6P
 | | HDAC-PC-Nuc | | Descriptor: | DNA (145-MER), HDA1 complex subunit 2, HDA1 complex subunit 3,HDA1 complex subunit 3, ... | | Authors: | Lee, J.-H, Bollschweiler, D, Schaefer, T, Huber, R. | | Deposit date: | 2020-05-28 | | Release date: | 2021-02-17 | | Method: | ELECTRON MICROSCOPY (4.43 Å) | | Cite: | Structural basis for the regulation of nucleosome recognition and HDAC activity by histone deacetylase assemblies.
Sci Adv, 7, 2021
|
|
1ID3
 | | CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | | Authors: | White, C.L, Suto, R.K, Luger, K. | | Deposit date: | 2001-04-03 | | Release date: | 2001-09-28 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
|
|
7A08
 | | CryoEM Structure of cGAS Nucleosome complex | | Descriptor: | Cyclic GMP-AMP synthase, Histone H2A type 1-C, Histone H2B type 1-C/E/F/G/I, ... | | Authors: | Michalski, S, de Oliveira Mann, C.C, Witte, G, Bartho, J, Lammens, K, Hopfner, K.P. | | Deposit date: | 2020-08-07 | | Release date: | 2020-09-23 | | Last modified: | 2021-02-10 | | Method: | ELECTRON MICROSCOPY (3.11 Å) | | Cite: | Structural basis for sequestration and autoinhibition of cGAS by chromatin.
Nature, 587, 2020
|
|
5OMX
 | |
5OXV
 | | Structure of the 4_601_157 tetranucleosome (C2 form) | | Descriptor: | DNA STRAND 1 (601-based sequence model), DNA STRAND 2 (601-based sequence model), Histone H2A, ... | | Authors: | Ekundayo, B, Schalch, T. | | Deposit date: | 2017-09-07 | | Release date: | 2017-10-11 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (6.721 Å) | | Cite: | Capturing Structural Heterogeneity in Chromatin Fibers.
J. Mol. Biol., 429, 2017
|
|
5ONG
 | | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | | Deposit date: | 2017-08-03 | | Release date: | 2017-11-22 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.797 Å) | | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability.
J. Mol. Biol., 430, 2018
|
|
5NL0
 | | Crystal structure of a 197-bp palindromic 601L nucleosome in complex with linker histone H1 | | Descriptor: | DNA (197-MER), Histone H1.0-B, Histone H2A type 1, ... | | Authors: | Garcia-Saez, I, Petosa, C, Dimitrov, S. | | Deposit date: | 2017-04-03 | | Release date: | 2017-05-17 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (5.4 Å) | | Cite: | Structure and Dynamics of a 197 bp Nucleosome in Complex with Linker Histone H1.
Mol. Cell, 66, 2017
|
|
6ZHY
 | | Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: hexasome class. | | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (110-MER) Widom 601 sequence, Histone H2A type 1, ... | | Authors: | Bacic, L, Gaullier, G, Deindl, S. | | Deposit date: | 2020-06-24 | | Release date: | 2020-12-23 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch.
Cell Rep, 33, 2020
|
|
1HQ3
 | | CRYSTAL STRUCTURE OF THE HISTONE-CORE-OCTAMER IN KCL/PHOSPHATE | | Descriptor: | CHLORIDE ION, HISTONE H2A-IV, HISTONE H2B, ... | | Authors: | Chantalat, L, Nicholson, J.M, Lambert, S.J, Reid, A.J, Donovan, M.J, Reynolds, C.D, Wood, C.M, Baldwin, J.P. | | Deposit date: | 2000-12-14 | | Release date: | 2001-01-24 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Structure of the histone-core octamer in KCl/phosphate crystals at 2.15 A resolution.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
