[English] 日本語
Yorodumi
- PDB-9exd: SV40 LTAg assembly in presence of ATP. -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9exd
TitleSV40 LTAg assembly in presence of ATP.
ComponentsLarge T antigen
KeywordsDNA BINDING PROTEIN / AAA+ superfamily / Helicase / Substrate translocation / DNA unwinding
Function / homology
Function and homology information


symbiont-mediated suppression of host JAK-STAT cascade via inhibition of JAK1 activity / bidirectional double-stranded viral DNA replication / viral DNA genome replication / symbiont-mediated perturbation of host cell cycle G1/S transition checkpoint / 3'-5' DNA helicase activity / DNA 3'-5' helicase / DNA replication origin binding / single-stranded DNA binding / double-stranded DNA binding / symbiont-mediated perturbation of host ubiquitin-like protein modification ...symbiont-mediated suppression of host JAK-STAT cascade via inhibition of JAK1 activity / bidirectional double-stranded viral DNA replication / viral DNA genome replication / symbiont-mediated perturbation of host cell cycle G1/S transition checkpoint / 3'-5' DNA helicase activity / DNA 3'-5' helicase / DNA replication origin binding / single-stranded DNA binding / double-stranded DNA binding / symbiont-mediated perturbation of host ubiquitin-like protein modification / DNA replication / symbiont-mediated suppression of host innate immune response / symbiont-mediated suppression of host type I interferon-mediated signaling pathway / host cell nucleus / DNA-templated transcription / ATP hydrolysis activity / zinc ion binding / ATP binding / identical protein binding
Similarity search - Function
Large T antigen, polyomaviridae / Origin of replication binding protein / Large T-antigen (T-ag) origin-binding domain (OBD) profile. / T antigen, Ori-binding / Large T antigen, polyomavirus, C-terminal / Zinc finger, large T-antigen D1-type / Polyomavirus large T antigen C-terminus / Zinc finger large T-antigen (T-ag) D1-type profile. / Zinc finger, large T-antigen D1 domain superfamily / Helicase, superfamily 3, DNA virus ...Large T antigen, polyomaviridae / Origin of replication binding protein / Large T-antigen (T-ag) origin-binding domain (OBD) profile. / T antigen, Ori-binding / Large T antigen, polyomavirus, C-terminal / Zinc finger, large T-antigen D1-type / Polyomavirus large T antigen C-terminus / Zinc finger large T-antigen (T-ag) D1-type profile. / Zinc finger, large T-antigen D1 domain superfamily / Helicase, superfamily 3, DNA virus / Superfamily 3 helicase of DNA viruses domain profile. / DnaJ molecular chaperone homology domain / dnaJ domain profile. / Chaperone J-domain superfamily / DnaJ domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE-5'-TRIPHOSPHATE / Large T antigen
Similarity search - Component
Biological speciesBetapolyomavirus macacae
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.4 Å
AuthorsShahid, T.
Funding support United Kingdom, Saudi Arabia, 2items
OrganizationGrant numberCountry
Medical Research Council (MRC, United Kingdom)MC_PC_17136 United Kingdom
Other private Saudi Arabia
CitationJournal: Nature / Year: 2025
Title: Structural dynamics of DNA unwinding by a replicative helicase.
Authors: Taha Shahid / Ammar U Danazumi / Muhammad Tehseen / Lubna Alhudhali / Alice R Clark / Christos G Savva / Samir M Hamdan / Alfredo De Biasio /
Abstract: Hexameric helicases are nucleotide-driven molecular machines that unwind DNA to initiate replication across all domains of life. Despite decades of intensive study, several critical aspects of their ...Hexameric helicases are nucleotide-driven molecular machines that unwind DNA to initiate replication across all domains of life. Despite decades of intensive study, several critical aspects of their function remain unresolved: the site and mechanism of DNA strand separation, the mechanics of unwinding propagation, and the dynamic relationship between nucleotide hydrolysis and DNA movement. Here, using cryo-electron microscopy (cryo-EM), we show that the simian virus 40 large tumour antigen (LTag) helicase assembles in the form of head-to-head hexamers at replication origins, melting DNA at two symmetrically positioned sites to establish bidirectional replication forks. Through continuous heterogeneity analysis, we characterize the conformational landscape of LTag on forked DNA under catalytic conditions, demonstrating coordinated motions that drive DNA translocation and unwinding. We show that the helicase pulls the tracking strand through DNA-binding loops lining the central channel, while directing the non-tracking strand out of the rear, in a cyclic process. ATP hydrolysis functions as an 'entropy switch', removing blocks to translocation rather than directly powering DNA movement. Our structures show the allosteric couplings between nucleotide turnover and subunit motions that enable DNA unwinding while maintaining dedicated exit paths for the separated strands. These findings provide a comprehensive model for replication fork establishment and progression that extends from viral to eukaryotic systems. More broadly, they introduce fundamental principles of the mechanism by which ATP-dependent enzymes achieve efficient mechanical work through entropy-driven allostery.
History
DepositionApr 7, 2024Deposition site: PDBE / Processing site: PDBE
Revision 1.0Feb 5, 2025Provider: repository / Type: Initial release
Revision 1.1Apr 2, 2025Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed ..._citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.identifier_ORCID / _em_admin.last_update
Revision 1.2May 7, 2025Group: Data collection / Database references / Category: citation / em_admin
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Large T antigen
B: Large T antigen
C: Large T antigen
D: Large T antigen
E: Large T antigen
F: Large T antigen
hetero molecules


Theoretical massNumber of molelcules
Total (without water)493,44112
Polymers490,3986
Non-polymers3,0436
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

#1: Protein
Large T antigen / LT / LT-AG


Mass: 81732.953 Da / Num. of mol.: 6
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Betapolyomavirus macacae / Cell line (production host): Sf9 / Production host: Spodoptera frugiperda (fall armyworm)
References: UniProt: P03070, Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement
#2: Chemical
ChemComp-ATP / ADENOSINE-5'-TRIPHOSPHATE


Mass: 507.181 Da / Num. of mol.: 6 / Source method: obtained synthetically / Formula: C10H16N5O13P3 / Feature type: SUBJECT OF INVESTIGATION / Comment: ATP, energy-carrying molecule*YM
Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeDetails (eV)Entity IDParent-IDSource
1Large T antigenCOMPLEXReconstituted with a gapped DNA substrate, i.e. ssDNA flanked by dsDNA at one side and a hairpin on the other side. The specimen showed no binding to the substrate. The constituent oligonucleotides of the annealed DNA were: AGCTATGACCATGATTACGAATTG[23ddC] & TTTTTCGGAGTCGTTTCGACTCCG ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAATTCGTAATCATGGTCATAGCT.#10MULTIPLE SOURCES
2Large T antigenCOMPLEX#11RECOMBINANT
Molecular weightExperimental value: NO
Source (natural)Organism: Betapolyomavirus macacae
Source (recombinant)Organism: Spodoptera frugiperda (fall armyworm) / Cell: Sf9
Buffer solutionpH: 8 / Details: 200 mM NaCl, 50 mM Tris-HCl (pH 8.0), 1 mM ATP.
SpecimenConc.: 0.1 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid type: UltrAuFoil
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 105000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 1000 nm / Cs: 2.7 mm / C2 aperture diameter: 50 µm
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingAverage exposure time: 2 sec. / Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) / Num. of real images: 4304
EM imaging opticsEnergyfilter name: GIF Bioquantum / Energyfilter slit width: 20 eV

-
Processing

EM software
IDNameVersionCategoryDetails (eV)
1Topazparticle selection
2EPUimage acquisition
4CTFFIND4CTF correction
5RELION4CTF correction
6cryoSPARCCTF correction
7RELION5CTF correction
10PHENIXmodel fitting
11UCSF ChimeraXmodel fitting
12ISOLDEmodel fitting
14cryoSPARCinitial Euler assignment
15RELION5final Euler assignmentBlush regularisation
16RELION5classificationBlush regularisation
17RELION53D reconstructionBlush regularisation
18ISOLDEmodel refinement
19PHENIXmodel refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 92330 / Symmetry type: POINT
Atomic model buildingProtocol: OTHER / Space: REAL
Atomic model building
IDPDB-ID 3D fitting-IDAccession codeInitial refinement model-IDSource nameType
11SVM11SVL1PDBexperimental model
21AlphaFoldin silico model

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more