[English] 日本語
![](img/lk-miru.gif)
- PDB-8dk3: CryoEM structure of Pseudomonas aeruginosa PA14 JetC ATPase domai... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 8dk3 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | CryoEM structure of Pseudomonas aeruginosa PA14 JetC ATPase domain bound to DNA and cWHD domain of JetA | |||||||||
![]() |
| |||||||||
![]() | DNA BINDING PROTEIN/DNA / Wadjet / Bacterial defense systems / JetA / JetC / Anti-plasmid defense system / EptA / EptC / MksB / MksF / SMC / DNA BINDING PROTEIN-DNA complex | |||||||||
Function / homology | Protein of unknown function DUF3375 / Protein of unknown function (DUF3375) / P-loop containing nucleoside triphosphate hydrolase / PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER / DNA / DNA (> 10) / DUF3375 domain-containing protein / ATP synthase![]() | |||||||||
Biological species | ![]() synthetic construct (others) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.28 Å | |||||||||
![]() | Deep, A. / Gu, Y. / Gao, Y. / Ego, K. / Herzik, M. / Zhou, H. / Corbett, K. | |||||||||
Funding support | ![]()
| |||||||||
![]() | ![]() Title: The SMC-family Wadjet complex protects bacteria from plasmid transformation by recognition and cleavage of closed-circular DNA. Authors: Amar Deep / Yajie Gu / Yong-Qi Gao / Kaori M Ego / Mark A Herzik / Huilin Zhou / Kevin D Corbett / ![]() Abstract: Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through ...Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through their sequence and their methylation state, respectively. Here, we show that the Wadjet defense system recognizes DNA topology to protect its host against plasmid transformation. By combining cryoelectron microscopy with cross-linking mass spectrometry, we show that Wadjet forms a complex similar to the bacterial condensin complex MukBEF, with a novel nuclease subunit similar to a type II DNA topoisomerase. Wadjet specifically cleaves closed-circular DNA in a reaction requiring ATP hydrolysis by the structural maintenance of chromosome (SMC) ATPase subunit JetC, suggesting that the complex could use DNA loop extrusion to sense its substrate's topology, then specifically activate the nuclease subunit JetD to cleave plasmid DNA. Overall, our data reveal how bacteria have co-opted a DNA maintenance machine to specifically recognize and destroy foreign DNAs through topology sensing. | |||||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 272 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 190 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.4 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.4 MB | Display | |
Data in XML | ![]() | 42.9 KB | Display | |
Data in CIF | ![]() | 63.5 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 27482MC ![]() 7tilC ![]() 8dk1C ![]() 8dk2C C: citing same article ( M: map data used to model this data |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Protein , 2 types, 3 molecules ABC
#1: Protein | Mass: 126683.180 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Details: The sequence contains mutation: E1022Q. / Source: (gene. exp.) ![]() ![]() ![]() #2: Protein | | Mass: 59233.500 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: cWHD domain of JetA observed in complex with dimeric JetC. Source: (gene. exp.) ![]() ![]() ![]() |
---|
-DNA chain , 2 types, 2 molecules PQ
#3: DNA chain | Mass: 7864.056 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC Source: (synth.) synthetic construct (others) |
---|---|
#4: DNA chain | Mass: 8098.421 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC Source: (synth.) synthetic construct (others) |
-Non-polymers , 2 types, 4 molecules ![](data/chem/img/AGS.gif)
![](data/chem/img/MG.gif)
![](data/chem/img/MG.gif)
#5: Chemical | #6: Chemical | |
---|
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component | Name: JetC head ATPase domain in complex with DNA, and cWHD of JetA Type: COMPLEX / Entity ID: #1-#4 / Source: MULTIPLE SOURCES | ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Value: 0.11 MDa / Experimental value: NO | ||||||||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||||||||
Source (recombinant) | Organism: ![]() ![]() | ||||||||||||||||||||||||||||||
Buffer solution | pH: 7.5 Details: Prepared using deionized water and filtered sterilized. | ||||||||||||||||||||||||||||||
Buffer component |
| ||||||||||||||||||||||||||||||
Specimen | Conc.: 1.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||||||||
Specimen support | Grid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3 | ||||||||||||||||||||||||||||||
Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: ![]() |
Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm |
Image recording | Electron dose: 50.1 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) |
-
Processing
Software | Name: PHENIX / Version: 1.20.1_4487: / Classification: refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EM software | Name: cryoSPARC / Version: 3.3.1 / Category: CTF correction | ||||||||||||||||||||||||
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
3D reconstruction | Resolution: 3.28 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 323026 / Algorithm: FOURIER SPACE / Symmetry type: POINT | ||||||||||||||||||||||||
Atomic model building | Protocol: AB INITIO MODEL / Space: REAL | ||||||||||||||||||||||||
Refine LS restraints |
|