[English] 日本語
Yorodumi- PDB-8dk2: CryoEM structure of Pseudomonas aeruginosa PA14 JetABC in an uncl... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 8dk2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | CryoEM structure of Pseudomonas aeruginosa PA14 JetABC in an unclamped state trapped in ATP dependent dimeric form | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN/DNA / Wadjet / Bacterial defense systems / JetA / JetB / JetC / Anti-plasmid defense system / EptA / EptB / EptC / MksB / MksE / MksF / SMC / DNA BINDING PROTEIN-DNA complex | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationWadjet protein JetB / Wadjet protein JetB / Protein of unknown function DUF3375 / Protein of unknown function (DUF3375) / P-loop containing nucleoside triphosphate hydrolase Similarity search - Domain/homology | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Biological species | Pseudomonas aeruginosa PA14 (bacteria)synthetic construct (others) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.1 Å | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Deep, A. / Gu, Y. / Gao, Y. / Ego, K. / Herzik, M. / Zhou, H. / Corbett, K. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Funding support | United States, 2items
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Citation | Journal: Mol Cell / Year: 2022Title: The SMC-family Wadjet complex protects bacteria from plasmid transformation by recognition and cleavage of closed-circular DNA. Authors: Amar Deep / Yajie Gu / Yong-Qi Gao / Kaori M Ego / Mark A Herzik / Huilin Zhou / Kevin D Corbett / ![]() Abstract: Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through ...Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through their sequence and their methylation state, respectively. Here, we show that the Wadjet defense system recognizes DNA topology to protect its host against plasmid transformation. By combining cryoelectron microscopy with cross-linking mass spectrometry, we show that Wadjet forms a complex similar to the bacterial condensin complex MukBEF, with a novel nuclease subunit similar to a type II DNA topoisomerase. Wadjet specifically cleaves closed-circular DNA in a reaction requiring ATP hydrolysis by the structural maintenance of chromosome (SMC) ATPase subunit JetC, suggesting that the complex could use DNA loop extrusion to sense its substrate's topology, then specifically activate the nuclease subunit JetD to cleave plasmid DNA. Overall, our data reveal how bacteria have co-opted a DNA maintenance machine to specifically recognize and destroy foreign DNAs through topology sensing. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 8dk2.cif.gz | 556.4 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb8dk2.ent.gz | 434.7 KB | Display | PDB format |
| PDBx/mmJSON format | 8dk2.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/dk/8dk2 ftp://data.pdbj.org/pub/pdb/validation_reports/dk/8dk2 | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 27481MC ![]() 7tilC ![]() 8dk1C ![]() 8dk3C C: citing same article ( M: map data used to model this data |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein , 3 types, 8 molecules ABCDFGHI
| #1: Protein | Mass: 59233.500 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: PA14_03250 / Production host: ![]() #2: Protein | Mass: 126683.180 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: IPC1494_27645, IPC1595_14260, IPC607_32065 / Production host: ![]() #3: Protein | Mass: 27537.037 Da / Num. of mol.: 4 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: PA14_03265 / Production host: ![]() |
|---|
-DNA chain , 2 types, 2 molecules PQ
| #4: DNA chain | Mass: 7864.056 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC Source: (synth.) synthetic construct (others) |
|---|---|
| #5: DNA chain | Mass: 8098.421 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC Source: (synth.) synthetic construct (others) |
-Non-polymers , 2 types, 4 molecules 


| #6: Chemical | | #7: Chemical | |
|---|
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | N |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: Reconstituted JetABC complex in the presence of DNA and ATP gamma S. Type: COMPLEX / Entity ID: #1-#5 / Source: MULTIPLE SOURCES | ||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: 0.481 MDa / Experimental value: NO | ||||||||||||||||||||||||||||||
| Source (natural) |
| ||||||||||||||||||||||||||||||
| Source (recombinant) | Organism: ![]() | ||||||||||||||||||||||||||||||
| Buffer solution | pH: 7.5 Details: Prepared using deionized water and filtered sterilized. | ||||||||||||||||||||||||||||||
| Buffer component |
| ||||||||||||||||||||||||||||||
| Specimen | Conc.: 1.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||||||||
| Specimen support | Grid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3 | ||||||||||||||||||||||||||||||
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm |
| Image recording | Electron dose: 50.1 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) |
-
Processing
| Software | Name: PHENIX / Version: 1.20.1_4487: / Classification: refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| ||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 4.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 56600 / Symmetry type: POINT | ||||||||||||||||||||||||
| Atomic model building | Protocol: AB INITIO MODEL / Space: REAL | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Pseudomonas aeruginosa PA14 (bacteria)
United States, 2items
Citation






PDBj







































light scattering
