[English] 日本語
Yorodumi
- PDB-6z9t: Transcription termination intermediate complex 5 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6z9t
TitleTranscription termination intermediate complex 5
Components
  • (DNA-directed RNA polymerase subunit ...) x 4
  • (Transcription ...) x 2
  • non template strand
  • rut RNA
  • template strand
KeywordsTRANSCRIPTION / Termination / Helicase / RNA Polymerase
Function / homology
Function and homology information


ATP-dependent activity, acting on RNA / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / regulation of DNA-templated transcription initiation / protein complex oligomerization / bacterial-type flagellum assembly / bacterial-type RNA polymerase core enzyme binding / cytosolic DNA-directed RNA polymerase complex / bacterial-type flagellum-dependent cell motility ...ATP-dependent activity, acting on RNA / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / regulation of DNA-templated transcription initiation / protein complex oligomerization / bacterial-type flagellum assembly / bacterial-type RNA polymerase core enzyme binding / cytosolic DNA-directed RNA polymerase complex / bacterial-type flagellum-dependent cell motility / translation elongation factor activity / nitrate assimilation / regulation of DNA-templated transcription elongation / transcription elongation factor complex / helicase activity / DNA-directed RNA polymerase complex / transcription antitermination / DNA-templated transcription initiation / cell motility / DNA-templated transcription termination / ribonucleoside binding / Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement / DNA-directed RNA polymerase / DNA-directed RNA polymerase activity / response to heat / ribosome biogenesis / protein-containing complex assembly / intracellular iron ion homeostasis / protein dimerization activity / DNA-binding transcription factor activity / protein domain specific binding / nucleotide binding / response to antibiotic / hydrolase activity / DNA-templated transcription / magnesium ion binding / DNA binding / RNA binding / zinc ion binding / ATP binding / membrane / identical protein binding / cytoplasm / cytosol
Similarity search - Function
Transcription termination factor Rho / Rho termination factor, N-terminal / Rho termination factor, RNA-binding domain / Transcription termination factor Rho, ATP binding domain / Rho termination factor, RNA-binding domain / Rho termination factor, N-terminal domain / Rho RNA-binding domain profile. / Rho termination factor, N-terminal domain / Rho termination factor, N-terminal domain superfamily / : ...Transcription termination factor Rho / Rho termination factor, N-terminal / Rho termination factor, RNA-binding domain / Transcription termination factor Rho, ATP binding domain / Rho termination factor, RNA-binding domain / Rho termination factor, N-terminal domain / Rho RNA-binding domain profile. / Rho termination factor, N-terminal domain / Rho termination factor, N-terminal domain superfamily / : / NusA-like second KH domain / Transcription termination factor NusA, C-terminal duplication / Transcription termination factor NusA / Transcription factor NusA, N-terminal / KH domain, NusA-like / NusA, N-terminal domain superfamily / NusA N-terminal domain / NusA-like first KH domain / Transcription termination/antitermination protein NusA, bacterial / Cold shock domain / Cold shock protein domain / Type-1 KH domain profile. / DNA repair Rad51/transcription factor NusA, alpha-helical / Helix-hairpin-helix domain / S1 domain profile. / DNA-directed RNA polymerase, omega subunit / DNA-directed RNA polymerase, subunit beta-prime, bacterial type / ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain / ATP synthase alpha/beta family, nucleotide-binding domain / DNA-directed RNA polymerase, beta subunit, external 1 domain superfamily / DNA-directed RNA polymerase, beta subunit, external 1 domain / RNA polymerase beta subunit external 1 domain / RNA polymerase, alpha subunit, C-terminal / Bacterial RNA polymerase, alpha chain C terminal domain / DNA-directed RNA polymerase beta subunit, bacterial-type / DNA-directed RNA polymerase, alpha subunit / Ribosomal protein S1-like RNA-binding domain / S1 RNA binding domain / S1 domain / DNA-directed RNA polymerase, subunit beta-prime / RNA polymerase Rpb6 / RNA polymerase Rpb2, domain 2 superfamily / RNA polymerase, subunit omega/Rpo6/RPB6 / RNA polymerase Rpb6 / RNA polymerase Rpb1, domain 3 superfamily / RPB6/omega subunit-like superfamily / RNA polymerase Rpb1, clamp domain superfamily / RNA polymerase Rpb1, domain 3 / RNA polymerase Rpb1, domain 3 / RNA polymerase, beta subunit, protrusion / RNA polymerase beta subunit / RNA polymerase Rpb1, domain 1 / RNA polymerase Rpb1, domain 1 / DNA-directed RNA polymerase, insert domain / DNA-directed RNA polymerase, RpoA/D/Rpb3-type / RNA polymerase Rpb3/RpoA insert domain / RNA polymerase Rpb3/Rpb11 dimerisation domain / RNA polymerases D / RNA polymerase, alpha subunit / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb1, domain 2 / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb2, domain 2 / RNA polymerase Rpb2, domain 2 / RNA polymerase, N-terminal / RNA polymerase Rpb1, funnel domain superfamily / RNA polymerase I subunit A N-terminus / DNA-directed RNA polymerase, insert domain superfamily / RNA polymerase, RBP11-like subunit / RNA polymerase, beta subunit, conserved site / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 3 / RNA polymerase Rpb2, OB-fold / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 3 / RNA polymerases beta chain signature. / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain / DNA-directed RNA polymerase, subunit 2 / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain superfamily / RNA polymerase Rpb2, domain 6 / K homology domain superfamily, prokaryotic type / K homology domain-like, alpha/beta / Nucleic acid-binding, OB-fold / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE-5'-DIPHOSPHATE / BERYLLIUM TRIFLUORIDE ION / DNA / DNA (> 10) / RNA / RNA (> 10) / DNA-directed RNA polymerase subunit beta' / Transcription termination/antitermination protein NusA / DNA-directed RNA polymerase subunit alpha / DNA-directed RNA polymerase subunit omega ...ADENOSINE-5'-DIPHOSPHATE / BERYLLIUM TRIFLUORIDE ION / DNA / DNA (> 10) / RNA / RNA (> 10) / DNA-directed RNA polymerase subunit beta' / Transcription termination/antitermination protein NusA / DNA-directed RNA polymerase subunit alpha / DNA-directed RNA polymerase subunit omega / DNA-directed RNA polymerase subunit beta' / DNA-directed RNA polymerase subunit beta / DNA-directed RNA polymerase subunit beta / Transcription termination/antitermination protein NusA / Transcription termination factor Rho
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.1 Å
AuthorsSaid, N. / Hilal, T. / Loll, B. / Wahl, M.C.
Funding support Germany, 3items
OrganizationGrant numberCountry
German Research Foundation (DFG)RTG 2473-1 Germany
German Research Foundation (DFG)WA 1126/11-1 Germany
German Federal Ministry for Education and Research01DQ20006 Germany
CitationJournal: Science / Year: 2021
Title: Steps toward translocation-independent RNA polymerase inactivation by terminator ATPase ρ.
Authors: Nelly Said / Tarek Hilal / Nicholas D Sunday / Ajay Khatri / Jörg Bürger / Thorsten Mielke / Georgiy A Belogurov / Bernhard Loll / Ranjan Sen / Irina Artsimovitch / Markus C Wahl /
Abstract: Factor-dependent transcription termination mechanisms are poorly understood. We determined a series of cryo-electron microscopy structures portraying the hexameric adenosine triphosphatase (ATPase) ...Factor-dependent transcription termination mechanisms are poorly understood. We determined a series of cryo-electron microscopy structures portraying the hexameric adenosine triphosphatase (ATPase) ρ on a pathway to terminating NusA/NusG-modified elongation complexes. An open ρ ring contacts NusA, NusG, and multiple regions of RNA polymerase, trapping and locally unwinding proximal upstream DNA. NusA wedges into the ρ ring, initially sequestering RNA. Upon deflection of distal upstream DNA over the RNA polymerase zinc-binding domain, NusA rotates underneath one capping ρ subunit, which subsequently captures RNA. After detachment of NusG and clamp opening, RNA polymerase loses its grip on the RNA:DNA hybrid and is inactivated. Our structural and functional analyses suggest that ρ, and other termination factors across life, may use analogous strategies to allosterically trap transcription complexes in a moribund state.
History
DepositionJun 4, 2020Deposition site: PDBE / Processing site: PDBE
Revision 1.0Nov 4, 2020Provider: repository / Type: Initial release
Revision 1.1Feb 3, 2021Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year
Revision 2.0Apr 9, 2025Group: Advisory / Atomic model ...Advisory / Atomic model / Data collection / Database references / Derived calculations / Polymer sequence / Source and taxonomy / Structure summary
Category: atom_site / chem_comp_atom ...atom_site / chem_comp_atom / chem_comp_bond / database_2 / em_entity_assembly / entity / entity_poly / entity_poly_seq / entity_src_gen / pdbx_entity_nonpoly / pdbx_entity_src_syn / pdbx_entry_details / pdbx_nonpoly_scheme / pdbx_poly_seq_scheme / pdbx_struct_assembly_gen / pdbx_struct_conn_angle / pdbx_unobs_or_zero_occ_atoms / pdbx_unobs_or_zero_occ_residues / pdbx_validate_close_contact / pdbx_validate_polymer_linkage / struct_asym / struct_conn / struct_conn_type / struct_ref / struct_ref_seq / struct_site / struct_site_gen
Item: _atom_site.B_iso_or_equiv / _atom_site.Cartn_x ..._atom_site.B_iso_or_equiv / _atom_site.Cartn_x / _atom_site.Cartn_y / _atom_site.Cartn_z / _atom_site.auth_asym_id / _atom_site.auth_atom_id / _atom_site.auth_comp_id / _atom_site.auth_seq_id / _atom_site.group_PDB / _atom_site.label_asym_id / _atom_site.label_atom_id / _atom_site.label_comp_id / _atom_site.label_entity_id / _atom_site.label_seq_id / _atom_site.type_symbol / _database_2.pdbx_DOI / _database_2.pdbx_database_accession / _em_entity_assembly.entity_id_list / _entity_poly.pdbx_seq_one_letter_code / _entity_poly.pdbx_seq_one_letter_code_can / _entity_src_gen.pdbx_gene_src_gene / _pdbx_entity_src_syn.pdbx_end_seq_num / _pdbx_entry_details.has_protein_modification / _pdbx_struct_assembly_gen.asym_id_list / _pdbx_struct_conn_angle.ptnr1_label_asym_id / _pdbx_struct_conn_angle.ptnr3_label_asym_id / _pdbx_unobs_or_zero_occ_residues.auth_comp_id / _pdbx_unobs_or_zero_occ_residues.auth_seq_id / _pdbx_unobs_or_zero_occ_residues.label_comp_id / _pdbx_unobs_or_zero_occ_residues.label_seq_id / _struct_ref.db_code / _struct_ref.pdbx_align_begin / _struct_ref.pdbx_db_accession / _struct_ref_seq.db_align_beg / _struct_ref_seq.db_align_end / _struct_ref_seq.pdbx_auth_seq_align_end / _struct_ref_seq.pdbx_db_accession / _struct_ref_seq.seq_align_end / _struct_site.details / _struct_site.pdbx_auth_asym_id / _struct_site.pdbx_auth_seq_id / _struct_site_gen.auth_asym_id / _struct_site_gen.auth_seq_id / _struct_site_gen.label_asym_id / _struct_site_gen.label_seq_id

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-11091
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
f: Transcription termination factor Rho
a: Transcription termination factor Rho
b: Transcription termination factor Rho
c: Transcription termination factor Rho
d: Transcription termination factor Rho
e: Transcription termination factor Rho
A: Transcription termination/antitermination protein NusA
U: DNA-directed RNA polymerase subunit alpha
V: DNA-directed RNA polymerase subunit alpha
W: DNA-directed RNA polymerase subunit omega
X: DNA-directed RNA polymerase subunit beta
Y: DNA-directed RNA polymerase subunit beta'
L: template strand
K: non template strand
R: rut RNA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)794,31833
Polymers791,57615
Non-polymers2,74318
Water27015
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: gel filtration
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Transcription ... , 2 types, 7 molecules fabcdeA

#1: Protein
Transcription termination factor Rho / ATP-dependent helicase Rho


Mass: 47070.168 Da / Num. of mol.: 6
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: rho, nitA, psuA, rnsC, sbaA, tsu, b3783, JW3756
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: P0AG30, Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement
#2: Protein Transcription termination/antitermination protein NusA


Mass: 55060.812 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli)
Gene: nusA, A6581_13525, A8C65_02280, A9819_18195, A9R57_12710, A9X72_02950, AC789_1c35390, ACN002_3262, ACN68_12470, ACN81_18560, ACU57_14555, ACU90_11675, AJ318_05130, AM270_15620, AM464_08470, ...Gene: nusA, A6581_13525, A8C65_02280, A9819_18195, A9R57_12710, A9X72_02950, AC789_1c35390, ACN002_3262, ACN68_12470, ACN81_18560, ACU57_14555, ACU90_11675, AJ318_05130, AM270_15620, AM464_08470, AM465_07745, AMK83_06450, AML35_13995, ARC77_12295, AU473_05845, AUQ13_02965, AW059_15285, AWB10_02965, AWE53_007755, AWF59_011800, AWG78_015835, AZZ83_001443, B6V57_17910, B7C53_06460, B9N33_16970, BANRA_01789, BANRA_03826, BB545_09890, BFD68_02465, BHF03_08610, BHF46_07205, BHS87_17855, BIQ87_17925, BIU72_05295, BIZ41_14490, BJJ90_02880, BK373_10285, BK375_17175, BK383_15855, BMT91_09130, BN17_31141, BOH76_04800, BON63_14350, BON65_19800, BON66_12095, BON69_26670, BON71_25285, BON72_14050, BON75_23260, BON76_05640, BON94_12450, BON95_22130, BON96_06470, BTQ04_16590, BTQ06_11760, BUE81_19575, BvCms12BK_01027, BvCms2454_04844, BvCms28BK_03352, BvCms35BK_01521, BvCmsC61A_01481, BvCmsHHP001_01224, BvCmsHHP019_03131, BvCmsHHP056_02506, BvCmsKKP036_00266, BvCmsKKP061_00866, BvCmsKSNP073_02140, BvCmsKSNP081_00264, BvCmsKSNP120_03552, BvCmsKSP011_02072, BvCmsKSP024_00305, BvCmsKSP026_00480, BvCmsKSP045_01628, BvCmsKSP058_01862, BvCmsKSP067_01442, BvCmsKSP076_01608, BvCmsNSNP036_02129, BvCmsNSP006_04618, BvCmsNSP007_02229, BvCmsNSP047_04140, BvCmsOUP014_03610, BvCmsSINP011_04480, BvCmsSINP022_03541, BvCmsSIP019_00385, BvCmsSIP044_00115, BW690_05715, BWI89_22180, BWP17_10040, BXT93_11865, BZL31_05810, C2U48_17660, C4K41_03670, C5N07_18180, C5P44_00540, C7B06_16690, C7B07_10710, C9098_07900, C9114_15345, C9162_04220, C9E25_11380, C9E67_03485, C9Z23_02315, C9Z28_00495, C9Z29_07080, C9Z37_14770, C9Z39_14385, C9Z69_11065, C9Z70_06875, C9Z78_03425, CCZ14_12145, CCZ17_15255, CF006_16780, CG692_07185, CI693_03560, CI694_20950, CIG45_16160, CMR93_08950, CO706_14520, COD46_10645, CR538_03185, CR539_21135, CRD98_04825, CRM83_23610, CRT43_19205, CT146_02945, CUB99_16245, CVH05_10890, D2184_10395, D2185_00555, D3821_08435, D3C88_08620, D3O91_07735, D3Y67_18400, D4M06_11115, D6X76_04225, D7K63_12110, D7Y10_03480, D9D20_06165, D9D31_09845, D9D33_00520, D9E34_10725, D9E35_01735, D9E49_09485, D9F17_07090, D9G42_16790, D9H53_01085, D9H68_07450, D9H70_01530, D9I18_07065, D9I87_04950, D9I88_16540, D9I97_11390, D9J11_01020, D9J44_07740, D9J46_20540, D9J78_05020, D9K54_17930, D9L99_02550, DAH26_17205, DAH30_12985, DAH34_01870, DAH37_04365, DAH43_16670, DD762_19130, DEN89_09295, DEN97_16025, DEO04_19495, DEO19_06320, DJ487_12875, DJ503_10865, DL455_12590, DL545_03770, DMI04_04160, DMZ50_12310, DN627_01240, DN700_04485, DNB37_13595, DNR41_11075, DOY56_12135, DP258_01950, DQF57_03505, DQO13_01185, DS732_23585, DS966_19180, DTL43_04185, DTL90_07460, DTM10_07095, DU333_16810, DW236_11975, DXT69_05630, DXT71_00550, DXT73_13270, DXX80_009480, E0I42_14230, E0L04_19775, E2119_05760, E2127_02465, E2128_02605, E2129_05650, E2134_15705, E2135_07970, E5P22_12885, E5P28_13020, E5P37_13245, E5S42_11905, E5S47_02870, E5S61_05815, EA223_04935, EA250_06525, EA834_14925, EAI42_15045, EAI52_10000, EAX79_13120, EB509_07090, EB510_12295, EC1094V2_475, EC3234A_53c00480, EC382_14545, ECs4050, ECTO124_00620, ECTO6_00587, ED225_04160, ED607_10315, ED611_04170, ED648_02805, EF173_16895, EGT48_12340, EI021_03955, EI028_15160, EI032_08695, EIA21_02770, EIZ93_15765, EL75_0516, EL79_0538, EL80_0529, ELT20_05155, ELT23_06875, ELT33_08795, ELT34_10430, ELT48_07010, ELU82_09405, ELU96_15075, ELV05_02165, ELV13_06455, ELV24_06465, ELX79_02850, ELX83_01985, ELY05_03160, ELY23_12925, ELY24_06185, ELY50_10980, EO241_09470, EPS76_01475, EPS94_08345, EPT01_00525, EQ825_16425, ERS085365_00562, ERS085374_01906, ERS085379_00395, ERS085383_00719, ERS085386_00510, ERS085404_02209, ERS085406_02909, ERS085416_00332, ERS139211_00573, ERS150873_04324, EWK56_02885, EXM29_19885, ExPECSC065_00153, EXX06_09580, EXX13_07225, EXX55_08945, EXX71_13290, EXX78_16840, EXX87_04480, EYD11_02755, EYX82_02345, EYX99_26665, EYY34_08675, F1E19_22155, F7F18_01095, F7G01_14090, F7G03_16260, FKO60_06130, FNJ67_03685, FORC82_0590, FQ915_16570, FQR64_03145, FQU83_04620, FRV13_20655, FV293_08485, FV438_11000, FY127_14855, FZ043_21925, HmCms184_00231, HmCmsJML079_04422, HmCmsJML146_01153, HmCmsJML204_02228, HW43_20805, MJ49_14455, MS8345_03518, NCTC10089_00629, NCTC10090_03662, NCTC10767_01660, NCTC10865_00813, NCTC10974_00712, NCTC11022_03334, NCTC11126_02933, NCTC11341_01740, NCTC13127_00931, NCTC8179_06097, NCTC8621_00649, NCTC8959_03134, NCTC9045_00717, NCTC9055_02514, NCTC9058_01244, NCTC9062_02552, NCTC9075_00900, NCTC9081_01077, NCTC9111_00998, NCTC9119_00655, NCTC9434_00566, NCTC9701_00709, NCTC9703_05100, NCTC9706_02868, NCTC9969_00791, PGD_03947, PU06_19960, RG28_20965, RK56_014720, RX35_04256, SAMEA3472044_03332, SAMEA3472047_01872, SAMEA3472055_00400, SAMEA3472056_03072, SAMEA3472080_00945, SAMEA3472090_00548, SAMEA3472108_00102, SAMEA3472114_00483, SAMEA3472147_01878, SAMEA3485101_01710, SAMEA3752553_01187, SAMEA3752557_01875, SAMEA3752559_03273, SAMEA3752620_02341, SAMEA3753064_02936, SAMEA3753097_03302, SAMEA3753164_02300, SAMEA3753290_00148, SAMEA3753300_02131, SK85_03482, SY51_18275, U12A_03405, U14A_03402, UC41_24435, UN86_15490, UN91_15505, WQ89_06750, WR15_24550
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: C3SSN7, UniProt: P0AFF6*PLUS

-
DNA-directed RNA polymerase subunit ... , 4 types, 5 molecules UVWXY

#3: Protein DNA-directed RNA polymerase subunit alpha / RNAP subunit alpha / RNA polymerase subunit alpha / Transcriptase subunit alpha


Mass: 36558.680 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: rpoA, pez, phs, sez, b3295, JW3257
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: P0A7Z4, DNA-directed RNA polymerase
#4: Protein DNA-directed RNA polymerase subunit omega / RNAP omega subunit / RNA polymerase omega subunit / Transcriptase subunit omega


Mass: 10249.547 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: rpoZ, b3649, JW3624
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: P0A800, DNA-directed RNA polymerase
#5: Protein DNA-directed RNA polymerase subunit beta / RNAP subunit beta / RNA polymerase subunit beta / Transcriptase subunit beta


Mass: 150820.875 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: rpoB, Z5560, ECs4910
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: P0A8V4, UniProt: P0A8V2*PLUS, DNA-directed RNA polymerase
#6: Protein DNA-directed RNA polymerase subunit beta' / RNAP subunit beta' / RNA polymerase subunit beta' / Transcriptase subunit beta'


Mass: 156537.031 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli)
Gene: rpoC, A6581_23995, A6592_25550, A6V01_22675, A8C65_22170, A9P13_25145, A9R57_05210, A9X72_23915, AC789_1c43830, ACN002_4075, ACN68_05320, ACN81_23175, ACU57_23185, ACU90_26200, AM270_23445, ...Gene: rpoC, A6581_23995, A6592_25550, A6V01_22675, A8C65_22170, A9P13_25145, A9R57_05210, A9X72_23915, AC789_1c43830, ACN002_4075, ACN68_05320, ACN81_23175, ACU57_23185, ACU90_26200, AM270_23445, AM446_26250, AM464_13270, AMK83_15405, AML07_02735, AML35_27125, APT94_08715, APZ14_17345, ARC77_17020, AU473_00845, AUQ13_12340, AUS26_26460, AW059_24210, AWB10_24945, AWE53_003330, AWG90_024870, AZZ83_004736, B7C53_21460, B9M99_23215, BANRA_02658, BANRA_02959, BANRA_04874, BANRA_05060, BB545_03160, BE963_11280, BHF03_13085, BHF46_21990, BHS81_23830, BHS87_22295, BIQ87_22860, BIU72_18810, BIZ41_20460, BJJ90_25120, BK292_28025, BK296_22655, BK373_27210, BK375_25315, BK383_27720, BMT49_21005, BMT91_03285, BN17_39521, BOH76_00535, BON63_20110, BON65_15085, BON66_14380, BON69_07675, BON71_08940, BON72_17275, BON75_02240, BON76_16220, BON83_01620, BON87_25670, BON91_27070, BON92_00590, BON94_22185, BON95_12860, BON96_11000, BTQ04_24495, BTQ06_27265, BUE81_05360, BvCms12BK_01429, BvCms2454_04769, BvCms28BK_04518, BvCms35BK_02095, BvCmsC61A_02150, BvCmsHHP001_05236, BvCmsHHP019_04451, BvCmsHHP056_02607, BvCmsKKP061_02982, BvCmsKSNP073_02854, BvCmsKSNP081_04479, BvCmsKSNP120_03436, BvCmsKSP011_02756, BvCmsKSP024_02908, BvCmsKSP026_03362, BvCmsKSP045_04187, BvCmsKSP058_05144, BvCmsKSP067_02566, BvCmsNSNP036_01157, BvCmsNSP006_02615, BvCmsNSP007_05019, BvCmsNSP047_00271, BvCmsNSP072_02893, BvCmsOUP014_03200, BvCmsSINP011_03932, BvCmsSINP022_04155, BvCmsSIP019_00812, BvCmsSIP044_03274, BVL39_05360, BW690_26755, BWI89_17380, BWP17_22705, BXT93_12730, BZL31_04385, BZL69_05725, C2U48_12715, C5715_03850, C5N07_24540, C5P01_26050, C5P44_24170, C7235_23705, C7B02_25785, C7B06_24625, C7B07_24550, C7B08_25760, C9098_22155, C9114_22905, C9141_23610, C9160_23380, C9162_26345, C9201_22200, C9306_18300, C9E25_22085, C9E67_28655, C9Z03_20320, C9Z23_22490, C9Z28_21990, C9Z29_22175, C9Z37_20920, C9Z39_11515, C9Z43_22460, C9Z69_21605, C9Z70_22865, CA593_06020, CDC27_21560, CF006_23865, CI641_013325, CI693_09915, CI694_22465, CIG45_23820, CJU63_23545, CMR93_21720, CO706_19510, COD30_25650, COD46_23645, CR538_24210, CR539_01675, CRD98_23235, CRE06_23980, CRM83_18625, CRX46_23050, CV83915_02065, CVH05_03875, CWS33_24550, D0X26_26125, D2184_25090, D2185_24280, D2188_26590, D3821_09095, D3822_07080, D3O91_23490, D3P01_24335, D3Y67_18045, D4M06_24790, D6T60_24455, D6X76_25460, D7K63_24300, D7K66_23610, D9D20_23630, D9D31_17430, D9D43_22315, D9E34_21770, D9E35_23870, D9F17_24240, D9G48_16815, D9H53_22620, D9H68_20330, D9H70_22065, D9H94_18950, D9I18_21370, D9I87_21145, D9I88_19005, D9I97_19385, D9J03_21580, D9J11_22220, D9J44_24520, D9J60_24650, D9J78_24495, D9K48_24885, D9L89_22865, D9X97_23575, DAH18_24925, DAH26_25940, DAH30_23845, DAH34_21555, DAH37_22570, DAH43_24880, DBQ99_24540, DD762_22280, DEN89_26510, DEN97_23710, DEO04_24305, DEO19_24555, DIV22_03745, DJ487_24740, DJ503_21515, DL455_22980, DL545_23680, DLW88_24480, DM102_24810, DMI04_23195, DN627_23155, DN700_22970, DNB37_22370, DND16_22020, DOY56_23525, DP258_23435, DP277_21385, DQE83_24465, DQF57_23790, DQO13_23780, DTL43_13700, DTL90_24530, DTM10_25855, DU309_24205, DU321_23425, DW236_24545, DXT69_22805, DXT71_22310, DXT73_22940, DXX80_014100, E0I42_21900, E0K84_22885, E0L12_22045, E2112_20360, E2119_22340, E2127_20900, E2128_03185, E2129_21295, E2134_22790, E2135_19330, E4K55_23345, E5P22_12650, E5P28_08825, E5P37_21450, E5S42_21540, E5S47_23025, E5S58_21685, E5S61_22375, EA223_18745, EA410_23470, EAI42_07590, EAI46_11695, EAI52_22800, EAX79_24760, EB509_19940, EB510_23045, EB515_23245, EC1094V2_4282, EC3234A_76c00080, EC3426_00300, EC382_20005, ECs4911, ECTO6_04517, ED225_22845, ED607_18495, ED611_23935, ED648_18905, ED903_15585, ED944_23315, EEA45_21100, EEP23_09490, EF173_24455, EHH55_00715, EHJ36_22705, EI021_22070, EI028_22520, EI032_21250, EIA21_22525, EIZ93_16335, EJC75_19635, EL75_4201, EL79_4407, EL80_4314, ELT20_20720, ELT23_22660, ELU85_23590, ELV08_18690, ELV28_22250, ELY05_18165, EO241_25775, EPT01_21680, EQ820_22870, EQ823_21565, ERS085365_04275, ERS085366_03840, ERS085374_04587, ERS085379_04695, ERS085383_04736, ERS085386_04630, ERS085404_04514, ERS085416_04248, ERS139211_00022, ERS150873_04406, ERS150876_04849, EST51_23860, EVY14_16840, EXM29_02400, EXX06_24525, EXX23_22305, EXX24_23170, EXX53_21005, EXX55_24440, EXX71_22255, EXX78_24010, EXX87_24980, EYD11_21590, EYX82_16690, EYY34_19805, EYY78_22660, F1E13_23750, F1E19_21825, F7F11_23815, F7F18_24055, F7F29_25930, F7G01_23350, F7G03_24075, FAF34_028960, FNJ69_19110, FNJ83_24800, FORC82_4521, FQ915_26150, FQR64_21800, FRV13_16215, FV293_23430, FV438_22435, FWK02_01680, FY127_17750, FZ043_01140, GJ11_25200, HmCms184_03861, HmCmsJML074_03182, HmCmsJML079_04902, HmCmsJML204_03257, HMPREF3040_01778, HW43_01585, MJ49_09425, NCTC10082_02080, NCTC10090_02779, NCTC10429_00081, NCTC10865_05894, NCTC10974_05350, NCTC11181_01964, NCTC12950_05213, NCTC13127_06163, NCTC13148_04414, NCTC7927_05248, NCTC8500_05324, NCTC8960_02339, NCTC9036_04648, NCTC9044_02305, NCTC9045_05541, NCTC9050_02817, NCTC9055_01666, NCTC9058_02148, NCTC9062_03445, NCTC9077_05932, NCTC9111_04954, NCTC9119_05054, NCTC9701_04995, NCTC9706_02002, NCTC9777_01117, NCTC9969_04931, PGD_00622, PU06_15490, RG28_25345, RK56_017400, RX35_03755, SAMEA3472043_04866, SAMEA3472044_04873, SAMEA3472047_03500, SAMEA3472055_04947, SAMEA3472056_05309, SAMEA3472070_05093, SAMEA3472080_04815, SAMEA3472090_05006, SAMEA3472108_04971, SAMEA3472110_05082, SAMEA3472112_05167, SAMEA3472114_04967, SAMEA3472147_04120, SAMEA3484427_04984, SAMEA3484429_04987, SAMEA3484434_04725, SAMEA3485101_05497, SAMEA3485113_04495, SAMEA3752372_05079, SAMEA3752553_04905, SAMEA3752557_04844, SAMEA3752559_04855, SAMEA3752620_04699, SAMEA3753064_05329, SAMEA3753097_04845, SAMEA3753164_04786, SAMEA3753290_00018, SAMEA3753300_04884, SK85_04319, UC41_25650, UN86_14180, UN91_25445, WQ89_24675, WR15_01490, YDC107_2702
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: C3SIA2, UniProt: P0A8T7*PLUS, DNA-directed RNA polymerase

-
DNA chain , 2 types, 2 molecules LK

#7: DNA chain template strand


Mass: 16133.310 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: GTTATCCGCTCACAATGCCACACGCGCTGCTCGGCCGTTATTCGCAGCCC / Source: (synth.) synthetic construct (others)
#8: DNA chain non template strand


Mass: 15541.960 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
RNA chain , 1 types, 1 molecules R

#9: RNA chain rut RNA


Mass: 31693.904 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
Non-polymers , 5 types, 33 molecules

#10: Chemical
ChemComp-ADP / ADENOSINE-5'-DIPHOSPHATE


Mass: 427.201 Da / Num. of mol.: 5 / Source method: obtained synthetically / Formula: C10H15N5O10P2 / Comment: ADP, energy-carrying molecule*YM
#11: Chemical
ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 6 / Source method: obtained synthetically / Formula: Mg
#12: Chemical
ChemComp-BEF / BERYLLIUM TRIFLUORIDE ION


Mass: 66.007 Da / Num. of mol.: 5 / Source method: obtained synthetically / Formula: BeF3
#13: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Zn
#14: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 15 / Source method: isolated from a natural source / Formula: H2O

-
Details

Has ligand of interestN
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: transcription termination intermediate complex 5 / Type: COMPLEX / Details: Moribound state / Entity ID: #1-#6, #8-#9 / Source: RECOMBINANT
Molecular weightValue: 0.82 MDa / Experimental value: NO
Source (natural)Organism: Escherichia coli (E. coli)
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 7.6
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Tecnai Polara / Image courtesy: FEI Company
MicroscopyModel: FEI POLARA 300
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD
Image recordingElectron dose: 50 e/Å2 / Detector mode: SUPER-RESOLUTION / Film or detector model: GATAN K2 SUMMIT (4k x 4k)

-
Processing

EM software
IDNameVersionCategory
2Leginon3.3image acquisition
4CTFFIND4CTF correction
11cryoSPARC2.14final Euler assignment
12cisTEMclassification
13cryoSPARC2.143D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 4.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 38054 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more