+
Open data
-
Basic information
| Entry | Database: PDB / ID: 6z9t | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Transcription termination intermediate complex 5 | ||||||||||||
Components |
| ||||||||||||
Keywords | TRANSCRIPTION / Termination / Helicase / RNA Polymerase | ||||||||||||
| Function / homology | Function and homology informationATP-dependent activity, acting on RNA / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / regulation of DNA-templated transcription initiation / protein complex oligomerization / bacterial-type flagellum assembly / bacterial-type RNA polymerase core enzyme binding / cytosolic DNA-directed RNA polymerase complex / bacterial-type flagellum-dependent cell motility ...ATP-dependent activity, acting on RNA / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / regulation of DNA-templated transcription initiation / protein complex oligomerization / bacterial-type flagellum assembly / bacterial-type RNA polymerase core enzyme binding / cytosolic DNA-directed RNA polymerase complex / bacterial-type flagellum-dependent cell motility / translation elongation factor activity / nitrate assimilation / regulation of DNA-templated transcription elongation / transcription elongation factor complex / helicase activity / DNA-directed RNA polymerase complex / transcription antitermination / cell motility / DNA-templated transcription initiation / DNA-templated transcription termination / Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement / ribonucleoside binding / DNA-directed RNA polymerase / DNA-directed RNA polymerase activity / response to heat / ribosome biogenesis / protein-containing complex assembly / intracellular iron ion homeostasis / protein dimerization activity / DNA-binding transcription factor activity / protein domain specific binding / response to antibiotic / nucleotide binding / hydrolase activity / DNA-templated transcription / magnesium ion binding / DNA binding / RNA binding / zinc ion binding / ATP binding / membrane / identical protein binding / cytoplasm / cytosol Similarity search - Function | ||||||||||||
| Biological species | ![]() synthetic construct (others) | ||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.1 Å | ||||||||||||
Authors | Said, N. / Hilal, T. / Loll, B. / Wahl, M.C. | ||||||||||||
| Funding support | Germany, 3items
| ||||||||||||
Citation | Journal: Science / Year: 2021Title: Steps toward translocation-independent RNA polymerase inactivation by terminator ATPase ρ. Authors: Nelly Said / Tarek Hilal / Nicholas D Sunday / Ajay Khatri / Jörg Bürger / Thorsten Mielke / Georgiy A Belogurov / Bernhard Loll / Ranjan Sen / Irina Artsimovitch / Markus C Wahl / ![]() Abstract: Factor-dependent transcription termination mechanisms are poorly understood. We determined a series of cryo-electron microscopy structures portraying the hexameric adenosine triphosphatase (ATPase) ...Factor-dependent transcription termination mechanisms are poorly understood. We determined a series of cryo-electron microscopy structures portraying the hexameric adenosine triphosphatase (ATPase) ρ on a pathway to terminating NusA/NusG-modified elongation complexes. An open ρ ring contacts NusA, NusG, and multiple regions of RNA polymerase, trapping and locally unwinding proximal upstream DNA. NusA wedges into the ρ ring, initially sequestering RNA. Upon deflection of distal upstream DNA over the RNA polymerase zinc-binding domain, NusA rotates underneath one capping ρ subunit, which subsequently captures RNA. After detachment of NusG and clamp opening, RNA polymerase loses its grip on the RNA:DNA hybrid and is inactivated. Our structural and functional analyses suggest that ρ, and other termination factors across life, may use analogous strategies to allosterically trap transcription complexes in a moribund state. | ||||||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 6z9t.cif.gz | 1.1 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb6z9t.ent.gz | 929.8 KB | Display | PDB format |
| PDBx/mmJSON format | 6z9t.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/z9/6z9t ftp://data.pdbj.org/pub/pdb/validation_reports/z9/6z9t | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 11091MC ![]() 6z9pC ![]() 6z9qC ![]() 6z9rC ![]() 6z9sC ![]() 7adbC ![]() 7adcC ![]() 7addC ![]() 7adeC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Transcription ... , 2 types, 7 molecules fabcdeA
| #1: Protein | Mass: 47070.168 Da / Num. of mol.: 6 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: ![]() References: UniProt: P0AG30, Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement #2: Protein | | Mass: 55060.812 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: nusA, A6581_13525, A8C65_02280, A9819_18195, A9R57_12710, A9X72_02950, AC789_1c35390, ACN002_3262, ACN68_12470, ACN81_18560, ACU57_14555, ACU90_11675, AJ318_05130, AM270_15620, AM464_08470, ...Gene: nusA, A6581_13525, A8C65_02280, A9819_18195, A9R57_12710, A9X72_02950, AC789_1c35390, ACN002_3262, ACN68_12470, ACN81_18560, ACU57_14555, ACU90_11675, AJ318_05130, AM270_15620, AM464_08470, AM465_07745, AMK83_06450, AML35_13995, ARC77_12295, AU473_05845, AUQ13_02965, AW059_15285, AWB10_02965, AWE53_007755, AWF59_011800, AWG78_015835, AZZ83_001443, B6V57_17910, B7C53_06460, B9N33_16970, BANRA_01789, BANRA_03826, BB545_09890, BFD68_02465, BHF03_08610, BHF46_07205, BHS87_17855, BIQ87_17925, BIU72_05295, BIZ41_14490, BJJ90_02880, BK373_10285, BK375_17175, BK383_15855, BMT91_09130, BN17_31141, BOH76_04800, BON63_14350, BON65_19800, BON66_12095, BON69_26670, BON71_25285, BON72_14050, BON75_23260, BON76_05640, BON94_12450, BON95_22130, BON96_06470, BTQ04_16590, BTQ06_11760, BUE81_19575, BvCms12BK_01027, BvCms2454_04844, BvCms28BK_03352, BvCms35BK_01521, BvCmsC61A_01481, BvCmsHHP001_01224, BvCmsHHP019_03131, BvCmsHHP056_02506, BvCmsKKP036_00266, BvCmsKKP061_00866, BvCmsKSNP073_02140, BvCmsKSNP081_00264, BvCmsKSNP120_03552, BvCmsKSP011_02072, BvCmsKSP024_00305, BvCmsKSP026_00480, BvCmsKSP045_01628, BvCmsKSP058_01862, BvCmsKSP067_01442, BvCmsKSP076_01608, BvCmsNSNP036_02129, BvCmsNSP006_04618, BvCmsNSP007_02229, BvCmsNSP047_04140, BvCmsOUP014_03610, BvCmsSINP011_04480, BvCmsSINP022_03541, BvCmsSIP019_00385, BvCmsSIP044_00115, BW690_05715, BWI89_22180, BWP17_10040, BXT93_11865, BZL31_05810, C2U48_17660, C4K41_03670, C5N07_18180, C5P44_00540, C7B06_16690, C7B07_10710, C9098_07900, C9114_15345, C9162_04220, C9E25_11380, C9E67_03485, C9Z23_02315, C9Z28_00495, C9Z29_07080, C9Z37_14770, C9Z39_14385, C9Z69_11065, C9Z70_06875, C9Z78_03425, CCZ14_12145, CCZ17_15255, CF006_16780, CG692_07185, CI693_03560, CI694_20950, CIG45_16160, CMR93_08950, CO706_14520, COD46_10645, CR538_03185, CR539_21135, CRD98_04825, CRM83_23610, CRT43_19205, CT146_02945, CUB99_16245, CVH05_10890, D2184_10395, D2185_00555, D3821_08435, D3C88_08620, D3O91_07735, D3Y67_18400, D4M06_11115, D6X76_04225, D7K63_12110, D7Y10_03480, D9D20_06165, D9D31_09845, D9D33_00520, D9E34_10725, D9E35_01735, D9E49_09485, D9F17_07090, D9G42_16790, D9H53_01085, D9H68_07450, D9H70_01530, D9I18_07065, D9I87_04950, D9I88_16540, D9I97_11390, D9J11_01020, D9J44_07740, D9J46_20540, D9J78_05020, D9K54_17930, D9L99_02550, DAH26_17205, DAH30_12985, DAH34_01870, DAH37_04365, DAH43_16670, DD762_19130, DEN89_09295, DEN97_16025, DEO04_19495, DEO19_06320, DJ487_12875, DJ503_10865, DL455_12590, DL545_03770, DMI04_04160, DMZ50_12310, DN627_01240, DN700_04485, DNB37_13595, DNR41_11075, DOY56_12135, DP258_01950, DQF57_03505, DQO13_01185, DS732_23585, DS966_19180, DTL43_04185, DTL90_07460, DTM10_07095, DU333_16810, DW236_11975, DXT69_05630, DXT71_00550, DXT73_13270, DXX80_009480, E0I42_14230, E0L04_19775, E2119_05760, E2127_02465, E2128_02605, E2129_05650, E2134_15705, E2135_07970, E5P22_12885, E5P28_13020, E5P37_13245, E5S42_11905, E5S47_02870, E5S61_05815, EA223_04935, EA250_06525, EA834_14925, EAI42_15045, EAI52_10000, EAX79_13120, EB509_07090, EB510_12295, EC1094V2_475, EC3234A_53c00480, EC382_14545, ECs4050, ECTO124_00620, ECTO6_00587, ED225_04160, ED607_10315, ED611_04170, ED648_02805, EF173_16895, EGT48_12340, EI021_03955, EI028_15160, EI032_08695, EIA21_02770, EIZ93_15765, EL75_0516, EL79_0538, EL80_0529, ELT20_05155, ELT23_06875, ELT33_08795, ELT34_10430, ELT48_07010, ELU82_09405, ELU96_15075, ELV05_02165, ELV13_06455, ELV24_06465, ELX79_02850, ELX83_01985, ELY05_03160, ELY23_12925, ELY24_06185, ELY50_10980, EO241_09470, EPS76_01475, EPS94_08345, EPT01_00525, EQ825_16425, ERS085365_00562, ERS085374_01906, ERS085379_00395, ERS085383_00719, ERS085386_00510, ERS085404_02209, ERS085406_02909, ERS085416_00332, ERS139211_00573, ERS150873_04324, EWK56_02885, EXM29_19885, ExPECSC065_00153, EXX06_09580, EXX13_07225, EXX55_08945, EXX71_13290, EXX78_16840, EXX87_04480, EYD11_02755, EYX82_02345, EYX99_26665, EYY34_08675, F1E19_22155, F7F18_01095, F7G01_14090, F7G03_16260, FKO60_06130, FNJ67_03685, FORC82_0590, FQ915_16570, FQR64_03145, FQU83_04620, FRV13_20655, FV293_08485, FV438_11000, FY127_14855, FZ043_21925, HmCms184_00231, HmCmsJML079_04422, HmCmsJML146_01153, HmCmsJML204_02228, HW43_20805, MJ49_14455, MS8345_03518, NCTC10089_00629, NCTC10090_03662, NCTC10767_01660, NCTC10865_00813, NCTC10974_00712, NCTC11022_03334, NCTC11126_02933, NCTC11341_01740, NCTC13127_00931, NCTC8179_06097, NCTC8621_00649, NCTC8959_03134, NCTC9045_00717, NCTC9055_02514, NCTC9058_01244, NCTC9062_02552, NCTC9075_00900, NCTC9081_01077, NCTC9111_00998, NCTC9119_00655, NCTC9434_00566, NCTC9701_00709, NCTC9703_05100, NCTC9706_02868, NCTC9969_00791, PGD_03947, PU06_19960, RG28_20965, RK56_014720, RX35_04256, SAMEA3472044_03332, SAMEA3472047_01872, SAMEA3472055_00400, SAMEA3472056_03072, SAMEA3472080_00945, SAMEA3472090_00548, SAMEA3472108_00102, SAMEA3472114_00483, SAMEA3472147_01878, SAMEA3485101_01710, SAMEA3752553_01187, SAMEA3752557_01875, SAMEA3752559_03273, SAMEA3752620_02341, SAMEA3753064_02936, SAMEA3753097_03302, SAMEA3753164_02300, SAMEA3753290_00148, SAMEA3753300_02131, SK85_03482, SY51_18275, U12A_03405, U14A_03402, UC41_24435, UN86_15490, UN91_15505, WQ89_06750, WR15_24550 Production host: ![]() References: UniProt: C3SSN7, UniProt: P0AFF6*PLUS |
|---|
-DNA-directed RNA polymerase subunit ... , 4 types, 5 molecules UVWXY
| #3: Protein | Mass: 36558.680 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: ![]() References: UniProt: P0A7Z4, DNA-directed RNA polymerase #4: Protein | | Mass: 10249.547 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: ![]() References: UniProt: P0A800, DNA-directed RNA polymerase #5: Protein | | Mass: 150820.875 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: ![]() References: UniProt: P0A8V4, UniProt: P0A8V2*PLUS, DNA-directed RNA polymerase #6: Protein | | Mass: 156537.031 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: rpoC, A6581_23995, A6592_25550, A6V01_22675, A8C65_22170, A9P13_25145, A9R57_05210, A9X72_23915, AC789_1c43830, ACN002_4075, ACN68_05320, ACN81_23175, ACU57_23185, ACU90_26200, AM270_23445, ...Gene: rpoC, A6581_23995, A6592_25550, A6V01_22675, A8C65_22170, A9P13_25145, A9R57_05210, A9X72_23915, AC789_1c43830, ACN002_4075, ACN68_05320, ACN81_23175, ACU57_23185, ACU90_26200, AM270_23445, AM446_26250, AM464_13270, AMK83_15405, AML07_02735, AML35_27125, APT94_08715, APZ14_17345, ARC77_17020, AU473_00845, AUQ13_12340, AUS26_26460, AW059_24210, AWB10_24945, AWE53_003330, AWG90_024870, AZZ83_004736, B7C53_21460, B9M99_23215, BANRA_02658, BANRA_02959, BANRA_04874, BANRA_05060, BB545_03160, BE963_11280, BHF03_13085, BHF46_21990, BHS81_23830, BHS87_22295, BIQ87_22860, BIU72_18810, BIZ41_20460, BJJ90_25120, BK292_28025, BK296_22655, BK373_27210, BK375_25315, BK383_27720, BMT49_21005, BMT91_03285, BN17_39521, BOH76_00535, BON63_20110, BON65_15085, BON66_14380, BON69_07675, BON71_08940, BON72_17275, BON75_02240, BON76_16220, BON83_01620, BON87_25670, BON91_27070, BON92_00590, BON94_22185, BON95_12860, BON96_11000, BTQ04_24495, BTQ06_27265, BUE81_05360, BvCms12BK_01429, BvCms2454_04769, BvCms28BK_04518, BvCms35BK_02095, BvCmsC61A_02150, BvCmsHHP001_05236, BvCmsHHP019_04451, BvCmsHHP056_02607, BvCmsKKP061_02982, BvCmsKSNP073_02854, BvCmsKSNP081_04479, BvCmsKSNP120_03436, BvCmsKSP011_02756, BvCmsKSP024_02908, BvCmsKSP026_03362, BvCmsKSP045_04187, BvCmsKSP058_05144, BvCmsKSP067_02566, BvCmsNSNP036_01157, BvCmsNSP006_02615, BvCmsNSP007_05019, BvCmsNSP047_00271, BvCmsNSP072_02893, BvCmsOUP014_03200, BvCmsSINP011_03932, BvCmsSINP022_04155, BvCmsSIP019_00812, BvCmsSIP044_03274, BVL39_05360, BW690_26755, BWI89_17380, BWP17_22705, BXT93_12730, BZL31_04385, BZL69_05725, C2U48_12715, C5715_03850, C5N07_24540, C5P01_26050, C5P44_24170, C7235_23705, C7B02_25785, C7B06_24625, C7B07_24550, C7B08_25760, C9098_22155, C9114_22905, C9141_23610, C9160_23380, C9162_26345, C9201_22200, C9306_18300, C9E25_22085, C9E67_28655, C9Z03_20320, C9Z23_22490, C9Z28_21990, C9Z29_22175, C9Z37_20920, C9Z39_11515, C9Z43_22460, C9Z69_21605, C9Z70_22865, CA593_06020, CDC27_21560, CF006_23865, CI641_013325, CI693_09915, CI694_22465, CIG45_23820, CJU63_23545, CMR93_21720, CO706_19510, COD30_25650, COD46_23645, CR538_24210, CR539_01675, CRD98_23235, CRE06_23980, CRM83_18625, CRX46_23050, CV83915_02065, CVH05_03875, CWS33_24550, D0X26_26125, D2184_25090, D2185_24280, D2188_26590, D3821_09095, D3822_07080, D3O91_23490, D3P01_24335, D3Y67_18045, D4M06_24790, D6T60_24455, D6X76_25460, D7K63_24300, D7K66_23610, D9D20_23630, D9D31_17430, D9D43_22315, D9E34_21770, D9E35_23870, D9F17_24240, D9G48_16815, D9H53_22620, D9H68_20330, D9H70_22065, D9H94_18950, D9I18_21370, D9I87_21145, D9I88_19005, D9I97_19385, D9J03_21580, D9J11_22220, D9J44_24520, D9J60_24650, D9J78_24495, D9K48_24885, D9L89_22865, D9X97_23575, DAH18_24925, DAH26_25940, DAH30_23845, DAH34_21555, DAH37_22570, DAH43_24880, DBQ99_24540, DD762_22280, DEN89_26510, DEN97_23710, DEO04_24305, DEO19_24555, DIV22_03745, DJ487_24740, DJ503_21515, DL455_22980, DL545_23680, DLW88_24480, DM102_24810, DMI04_23195, DN627_23155, DN700_22970, DNB37_22370, DND16_22020, DOY56_23525, DP258_23435, DP277_21385, DQE83_24465, DQF57_23790, DQO13_23780, DTL43_13700, DTL90_24530, DTM10_25855, DU309_24205, DU321_23425, DW236_24545, DXT69_22805, DXT71_22310, DXT73_22940, DXX80_014100, E0I42_21900, E0K84_22885, E0L12_22045, E2112_20360, E2119_22340, E2127_20900, E2128_03185, E2129_21295, E2134_22790, E2135_19330, E4K55_23345, E5P22_12650, E5P28_08825, E5P37_21450, E5S42_21540, E5S47_23025, E5S58_21685, E5S61_22375, EA223_18745, EA410_23470, EAI42_07590, EAI46_11695, EAI52_22800, EAX79_24760, EB509_19940, EB510_23045, EB515_23245, EC1094V2_4282, EC3234A_76c00080, EC3426_00300, EC382_20005, ECs4911, ECTO6_04517, ED225_22845, ED607_18495, ED611_23935, ED648_18905, ED903_15585, ED944_23315, EEA45_21100, EEP23_09490, EF173_24455, EHH55_00715, EHJ36_22705, EI021_22070, EI028_22520, EI032_21250, EIA21_22525, EIZ93_16335, EJC75_19635, EL75_4201, EL79_4407, EL80_4314, ELT20_20720, ELT23_22660, ELU85_23590, ELV08_18690, ELV28_22250, ELY05_18165, EO241_25775, EPT01_21680, EQ820_22870, EQ823_21565, ERS085365_04275, ERS085366_03840, ERS085374_04587, ERS085379_04695, ERS085383_04736, ERS085386_04630, ERS085404_04514, ERS085416_04248, ERS139211_00022, ERS150873_04406, ERS150876_04849, EST51_23860, EVY14_16840, EXM29_02400, EXX06_24525, EXX23_22305, EXX24_23170, EXX53_21005, EXX55_24440, EXX71_22255, EXX78_24010, EXX87_24980, EYD11_21590, EYX82_16690, EYY34_19805, EYY78_22660, F1E13_23750, F1E19_21825, F7F11_23815, F7F18_24055, F7F29_25930, F7G01_23350, F7G03_24075, FAF34_028960, FNJ69_19110, FNJ83_24800, FORC82_4521, FQ915_26150, FQR64_21800, FRV13_16215, FV293_23430, FV438_22435, FWK02_01680, FY127_17750, FZ043_01140, GJ11_25200, HmCms184_03861, HmCmsJML074_03182, HmCmsJML079_04902, HmCmsJML204_03257, HMPREF3040_01778, HW43_01585, MJ49_09425, NCTC10082_02080, NCTC10090_02779, NCTC10429_00081, NCTC10865_05894, NCTC10974_05350, NCTC11181_01964, NCTC12950_05213, NCTC13127_06163, NCTC13148_04414, NCTC7927_05248, NCTC8500_05324, NCTC8960_02339, NCTC9036_04648, NCTC9044_02305, NCTC9045_05541, NCTC9050_02817, NCTC9055_01666, NCTC9058_02148, NCTC9062_03445, NCTC9077_05932, NCTC9111_04954, NCTC9119_05054, NCTC9701_04995, NCTC9706_02002, NCTC9777_01117, NCTC9969_04931, PGD_00622, PU06_15490, RG28_25345, RK56_017400, RX35_03755, SAMEA3472043_04866, SAMEA3472044_04873, SAMEA3472047_03500, SAMEA3472055_04947, SAMEA3472056_05309, SAMEA3472070_05093, SAMEA3472080_04815, SAMEA3472090_05006, SAMEA3472108_04971, SAMEA3472110_05082, SAMEA3472112_05167, SAMEA3472114_04967, SAMEA3472147_04120, SAMEA3484427_04984, SAMEA3484429_04987, SAMEA3484434_04725, SAMEA3485101_05497, SAMEA3485113_04495, SAMEA3752372_05079, SAMEA3752553_04905, SAMEA3752557_04844, SAMEA3752559_04855, SAMEA3752620_04699, SAMEA3753064_05329, SAMEA3753097_04845, SAMEA3753164_04786, SAMEA3753290_00018, SAMEA3753300_04884, SK85_04319, UC41_25650, UN86_14180, UN91_25445, WQ89_24675, WR15_01490, YDC107_2702 Production host: ![]() References: UniProt: C3SIA2, UniProt: P0A8T7*PLUS, DNA-directed RNA polymerase |
|---|
-DNA chain , 2 types, 2 molecules LK
| #7: DNA chain | Mass: 16133.310 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: GTTATCCGCTCACAATGCCACACGCGCTGCTCGGCCGTTATTCGCAGCCC / Source: (synth.) synthetic construct (others) |
|---|---|
| #8: DNA chain | Mass: 15541.960 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) |
-RNA chain , 1 types, 1 molecules R
| #9: RNA chain | Mass: 31693.904 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) |
|---|
-Non-polymers , 5 types, 33 molecules 








| #10: Chemical | ChemComp-ADP / #11: Chemical | ChemComp-MG / #12: Chemical | ChemComp-BEF / #13: Chemical | #14: Water | ChemComp-HOH / | |
|---|
-Details
| Has ligand of interest | N |
|---|---|
| Has protein modification | N |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: transcription termination intermediate complex 5 / Type: COMPLEX / Details: Moribound state / Entity ID: #1-#6, #8-#9 / Source: RECOMBINANT |
|---|---|
| Molecular weight | Value: 0.82 MDa / Experimental value: NO |
| Source (natural) | Organism: ![]() |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.6 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Tecnai Polara / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI POLARA 300 |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD |
| Image recording | Electron dose: 50 e/Å2 / Detector mode: SUPER-RESOLUTION / Film or detector model: GATAN K2 SUMMIT (4k x 4k) |
-
Processing
| EM software |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 4.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 38054 / Symmetry type: POINT |
Movie
Controller
About Yorodumi






Germany, 3items
Citation

UCSF Chimera


























PDBj




































































