[English] 日本語
Yorodumi
- PDB-6tnf: Structure of monoubiquitinated FANCD2 in complex with FANCI and DNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6tnf
TitleStructure of monoubiquitinated FANCD2 in complex with FANCI and DNA
Components
  • DNA (33-MER)
  • FANCD2
  • Fanconi anemia complementation group I
  • Polyubiquitin-C
KeywordsDNA BINDING PROTEIN / Fanconi anaemia / ubiquitin / DNA repair / DNA damage / inter-strand crosslink
Function / homology
Function and homology information


Fanconi Anemia Pathway in DNA repair / Fanconi Anemia Pathway / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / mitotic intra-S DNA damage checkpoint signaling / interstrand cross-link repair / DNA polymerase binding / condensed chromosome / Maturation of protein E / Maturation of protein E ...Fanconi Anemia Pathway in DNA repair / Fanconi Anemia Pathway / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / mitotic intra-S DNA damage checkpoint signaling / interstrand cross-link repair / DNA polymerase binding / condensed chromosome / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Membrane binding and targetting of GAG proteins / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / Endosomal Sorting Complex Required For Transport (ESCRT) / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Negative regulation of FLT3 / Constitutive Signaling by NOTCH1 HD Domain Mutants / Regulation of FZD by ubiquitination / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / NOTCH2 Activation and Transmission of Signal to the Nucleus / APC/C:Cdc20 mediated degradation of Cyclin B / p75NTR recruits signalling complexes / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / TRAF6-mediated induction of TAK1 complex within TLR4 complex / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / PINK1-PRKN Mediated Mitophagy / Pexophagy / Regulation of innate immune responses to cytosolic DNA / InlA-mediated entry of Listeria monocytogenes into host cells / VLDLR internalisation and degradation / Regulation of pyruvate metabolism / Downregulation of ERBB2:ERBB3 signaling / NF-kB is activated and signals survival / Regulation of PTEN localization / NRIF signals cell death from the nucleus / Regulation of BACH1 activity / Activated NOTCH1 Transmits Signal to the Nucleus / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by REV1 / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Translesion synthesis by POLK / TICAM1, RIP1-mediated IKK complex recruitment / Downregulation of TGF-beta receptor signaling / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / Josephin domain DUBs / Regulation of activated PAK-2p34 by proteasome mediated degradation / InlB-mediated entry of Listeria monocytogenes into host cell / IKK complex recruitment mediated by RIP1 / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / TNFR1-induced NF-kappa-B signaling pathway / Autodegradation of Cdh1 by Cdh1:APC/C / APC/C:Cdc20 mediated degradation of Securin / Asymmetric localization of PCP proteins / TCF dependent signaling in response to WNT / SCF-beta-TrCP mediated degradation of Emi1 / NIK-->noncanonical NF-kB signaling / Ubiquitin-dependent degradation of Cyclin D / Regulation of NF-kappa B signaling / AUF1 (hnRNP D0) binds and destabilizes mRNA / TNFR2 non-canonical NF-kB pathway / activated TAK1 mediates p38 MAPK activation / Vpu mediated degradation of CD4 / Assembly of the pre-replicative complex / Negative regulators of DDX58/IFIH1 signaling / Deactivation of the beta-catenin transactivating complex / Degradation of DVL / NOTCH3 Activation and Transmission of Signal to the Nucleus / Ubiquitin Mediated Degradation of Phosphorylated Cdc25A / Regulation of signaling by CBL / Dectin-1 mediated noncanonical NF-kB signaling / Cdc20:Phospho-APC/C mediated degradation of Cyclin A / Fanconi Anemia Pathway / Hh mutants are degraded by ERAD / Negative regulation of FGFR3 signaling / Degradation of AXIN / Peroxisomal protein import / Recognition of DNA damage by PCNA-containing replication complex / Degradation of GLI1 by the proteasome / Activation of NF-kappaB in B cells / Regulation of TNFR1 signaling / Negative regulation of FGFR2 signaling / Downregulation of SMAD2/3:SMAD4 transcriptional activity / Stabilization of p53 / Termination of translesion DNA synthesis
Similarity search - Function
Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 ...Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 / FANCI solenoid 2 / FANCI solenoid 3 / FANCI solenoid 4 / FANCI helical domain 1 / FANCI helical domain 2 / Fanconi anaemia protein FANCD2 / Fanconi anaemia protein FancD2 nuclease / : / Ubiquitin domain signature. / Ubiquitin conserved site / Ubiquitin domain / Ubiquitin family / Ubiquitin homologues / Ubiquitin domain profile. / Ubiquitin-like domain / Ubiquitin-like domain superfamily
Similarity search - Domain/homology
DNA / DNA (> 10) / Fanconi anemia complementation group I / Fanconi anemia complementation group D2 / Polyubiquitin-C
Similarity search - Component
Biological speciesGallus gallus (chicken)
Homo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.8 Å
AuthorsAlcon, P. / Shakeel, S. / Passmore, L.A.
Funding support United Kingdom, 2items
OrganizationGrant numberCountry
Medical Research Council (MRC, United Kingdom)MC_U105192715 United Kingdom
European Molecular Biology Organization (EMBO)ALTF 692-2018 United Kingdom
CitationJournal: Nat Struct Mol Biol / Year: 2020
Title: FANCD2-FANCI is a clamp stabilized on DNA by monoubiquitination of FANCD2 during DNA repair.
Authors: Pablo Alcón / Shabih Shakeel / Zhuo A Chen / Juri Rappsilber / Ketan J Patel / Lori A Passmore /
Abstract: Vertebrate DNA crosslink repair excises toxic replication-blocking DNA crosslinks. Numerous factors involved in crosslink repair have been identified, and mutations in their corresponding genes cause ...Vertebrate DNA crosslink repair excises toxic replication-blocking DNA crosslinks. Numerous factors involved in crosslink repair have been identified, and mutations in their corresponding genes cause Fanconi anemia (FA). A key step in crosslink repair is monoubiquitination of the FANCD2-FANCI heterodimer, which then recruits nucleases to remove the DNA lesion. Here, we use cryo-EM to determine the structures of recombinant chicken FANCD2 and FANCI complexes. FANCD2-FANCI adopts a closed conformation when the FANCD2 subunit is monoubiquitinated, creating a channel that encloses double-stranded DNA (dsDNA). Ubiquitin is positioned at the interface of FANCD2 and FANCI, where it acts as a covalent molecular pin to trap the complex on DNA. In contrast, isolated FANCD2 is a homodimer that is unable to bind DNA, suggestive of an autoinhibitory mechanism that prevents premature activation. Together, our work suggests that FANCD2-FANCI is a clamp that is locked onto DNA by ubiquitin, with distinct interfaces that may recruit other DNA repair factors.
History
DepositionDec 7, 2019Deposition site: PDBE / Processing site: PDBE
Revision 1.0Feb 19, 2020Provider: repository / Type: Initial release
Revision 1.1Feb 26, 2020Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _citation_author.identifier_ORCID / _citation_author.name
Revision 1.2Mar 18, 2020Group: Database references / Category: citation / citation_author
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation_author.identifier_ORCID
Revision 1.3May 22, 2024Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / em_3d_fitting_list / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _em_3d_fitting_list.accession_code / _em_3d_fitting_list.initial_refinement_model_id / _em_3d_fitting_list.source_name / _em_3d_fitting_list.type

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-10531
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: FANCD2
B: Fanconi anemia complementation group I
C: Polyubiquitin-C
D: DNA (33-MER)
E: DNA (33-MER)


Theoretical massNumber of molelcules
Total (without water)330,7645
Polymers330,7645
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: mass spectrometry
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein FANCD2


Mass: 160932.328 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Gallus gallus (chicken) / Gene: FANCD2 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: F1NP22
#2: Protein Fanconi anemia complementation group I


Mass: 149458.297 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Gallus gallus (chicken) / Gene: FANCI / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: B0I564
#3: Protein Polyubiquitin-C


Mass: 8576.831 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: Escherichia coli (E. coli) / References: UniProt: P0CG48
#4: DNA chain DNA (33-MER)


Mass: 5898.203 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: An idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides ...Details: An idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides X1, X2, X3, X4, X5, X6: X1: GCGCACCAAGAGATACGCGGTCGAATGCCGAGTAGCCATCAGCG X2: ACCATGCAGCTACTCGGCATTCGACCGCGTATCTGGCGACTACG X3: TATCTCTTGGTGCGC X4: CGCTGATGGCTACTC X5: CGTAGTCGCCAGATA X6: GAGTAGCTGCATGGT
Source: (synth.) synthetic construct (others)
Has ligand of interestN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSourceDetails
1Complex of monoubiquitinated FANCD2, FANCI and DNACOMPLEXall0RECOMBINANT
2FANCD2, FANCICOMPLEX#1-#21RECOMBINANT
3UBCCOMPLEX#31RECOMBINANT
4DNACOMPLEX#41RECOMBINANTAn idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides X1, X2, X3, X4, X5, X6: X1: GCGCACCAAGAGATACGCGGTCGAATGCCGAGTAGCCATCAGCG X2: ACCATGCAGCTACTCGGCATTCGACCGCGTATCTGGCGACTACG X3: TATCTCTTGGTGCGC X4: CGCTGATGGCTACTC X5: CGTAGTCGCCAGATA X6: GAGTAGCTGCATGGT
Molecular weightValue: 0.3 MDa / Experimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
12Gallus gallus (chicken)9031
23Homo sapiens (human)9606
34Synthetic construct (others)32630
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
12Spodoptera frugiperda (fall armyworm)7108
23Escherichia coli (E. coli)562
34Synthetic construct (others)32630
Buffer solutionpH: 8
Details: 50 mM HEPES, 100 mM imidazole, 150 mM NaCl, 1 mM TCEP
SpecimenConc.: 0.3 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277.15 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 3500 nm / Nominal defocus min: 1800 nm / Cs: 2.7 mm / C2 aperture diameter: 50 µm / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 70 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k)
EM imaging opticsEnergyfilter slit width: 20 eV

-
Processing

EM software
IDNameVersionCategory
2SerialEMimage acquisition
4CTFFIND4CTF correction
7UCSF Chimeramodel fitting
9RELIONinitial Euler assignment
10RELIONfinal Euler assignment
11RELIONclassification
12RELION3.13D reconstruction
13Cootmodel refinement
14PHENIXmodel refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 2500000
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 146245 / Symmetry type: POINT
Atomic model buildingProtocol: OTHER / Space: REAL
Atomic model building
IDPDB-ID 3D fitting-IDAccession codeInitial refinement model-IDSource nameType
13S4W13S4W1PDBexperimental model
21UBQ11UBQ2PDBexperimental model

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlc1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more