[English] 日本語
Yorodumi- PDB-6nd4: Conformational switches control early maturation of the eukaryoti... -
+Open data
-Basic information
Entry | Database: PDB / ID: 6nd4 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Conformational switches control early maturation of the eukaryotic small ribosomal subunit | |||||||||
Components |
| |||||||||
Keywords | RIBOSOME / Ribosome assembly | |||||||||
Function / homology | Function and homology information t-UTP complex / RNA fragment catabolic process / rRNA 2'-O-methylation / Pwp2p-containing subcomplex of 90S preribosome / histone H2AQ104 methyltransferase activity / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / rRNA modification / septum digestion after cytokinesis ...t-UTP complex / RNA fragment catabolic process / rRNA 2'-O-methylation / Pwp2p-containing subcomplex of 90S preribosome / histone H2AQ104 methyltransferase activity / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / rRNA modification / septum digestion after cytokinesis / snRNA binding / positive regulation of RNA binding / SUMOylation of RNA binding proteins / box C/D sno(s)RNA 3'-end processing / tRNA export from nucleus / regulation of transcription by RNA polymerase I / endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / rDNA heterochromatin / rRNA methyltransferase activity / positive regulation of rRNA processing / box C/D methylation guide snoRNP complex / U4/U6 snRNP / sno(s)RNA-containing ribonucleoprotein complex / U4 snRNA binding / protein localization to nucleolus / O-methyltransferase activity / U4 snRNP / rRNA methylation / U3 snoRNA binding / precatalytic spliceosome / preribosome, small subunit precursor / snoRNA binding / spliceosomal complex assembly / establishment of cell polarity / positive regulation of transcription by RNA polymerase I / Major pathway of rRNA processing in the nucleolus and cytosol / 90S preribosome / endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / maturation of SSU-rRNA / maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / maturation of LSU-rRNA / U4/U6 x U5 tri-snRNP complex / RNA endonuclease activity / Transferases; Transferring one-carbon groups; Methyltransferases / small-subunit processome / spliceosomal complex / ribosomal small subunit biogenesis / mRNA splicing, via spliceosome / ribosomal small subunit assembly / rRNA processing / small ribosomal subunit / cytosolic large ribosomal subunit / tRNA binding / rRNA binding / structural constituent of ribosome / mRNA binding / nucleolus / mitochondrion / RNA binding / nucleoplasm / identical protein binding / nucleus / cytoplasm Similarity search - Function | |||||||||
Biological species | Saccharomyces cerevisiae BY4741 (yeast) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.3 Å | |||||||||
Authors | Hunziker, M. / Barandun, J. / Klinge, S. | |||||||||
Funding support | United States, Switzerland, 2items
| |||||||||
Citation | Journal: Elife / Year: 2019 Title: Conformational switches control early maturation of the eukaryotic small ribosomal subunit. Authors: Mirjam Hunziker / Jonas Barandun / Olga Buzovetsky / Caitlin Steckler / Henrik Molina / Sebastian Klinge / Abstract: Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent ...Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent from the mature ribosome. The subsequent co-transcriptional association of ribosome assembly factors with pre-ribosomal RNA results in the formation of the small subunit processome. Here we show that stable rRNA domains of the small ribosomal subunit can independently recruit their own biogenesis factors in vivo. The final assembly and compaction of the small subunit processome requires the presence of the 5' external transcribed spacer RNA and all ribosomal RNA domains. Additionally, our cryo-electron microscopy structure of the earliest nucleolar pre-ribosomal assembly - the 5' external transcribed spacer ribonucleoprotein - provides a mechanism for how conformational changes in multi-protein complexes can be employed to regulate the accessibility of binding sites and therefore define the chronology of maturation events during early stages of ribosome assembly. | |||||||||
History |
|
-Structure visualization
Movie |
Movie viewer |
---|---|
Structure viewer | Molecule: MolmilJmol/JSmol |
-Downloads & links
-Download
PDBx/mmCIF format | 6nd4.cif.gz | 1.8 MB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb6nd4.ent.gz | 1.2 MB | Display | PDB format |
PDBx/mmJSON format | 6nd4.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/nd/6nd4 ftp://data.pdbj.org/pub/pdb/validation_reports/nd/6nd4 | HTTPS FTP |
---|
-Related structure data
Related structure data | 0441MC M: map data used to model this data C: citing same article (ref.) |
---|---|
Similar structure data |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
-RNA chain , 3 types, 3 molecules 012
#1: RNA chain | Mass: 220317.000 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Saccharomyces cerevisiae BY4741 (yeast) |
---|---|
#2: RNA chain | Mass: 3727.073 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Saccharomyces cerevisiae BY4741 (yeast) |
#3: RNA chain | Mass: 46932.852 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Saccharomyces cerevisiae BY4741 (yeast) |
+Protein , 24 types, 26 molecules HIJKLMNOPQRSTUWZADabcdefgl
-Protein/peptide , 1 types, 1 molecules x
#28: Protein/peptide | Mass: 2060.531 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Saccharomyces cerevisiae BY4741 (yeast) |
---|
-Details
Sequence details | The complete sample sequence of 5'ETS rRNA is AUGCGAAAGCAGUUGAAGACAAGUUCGAAAAGAGUUUGGAAACGAAUUCG ...The complete sample sequence of 5'ETS rRNA is AUGCGAAAGC |
---|