[English] 日本語
Yorodumi- PDB-6nd4: Conformational switches control early maturation of the eukaryoti... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 6nd4 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Conformational switches control early maturation of the eukaryotic small ribosomal subunit | |||||||||
Components |
| |||||||||
Keywords | RIBOSOME / Ribosome assembly | |||||||||
| Function / homology | Function and homology informationRNA fragment catabolic process / rRNA 2'-O-methylation / t-UTP complex / Pwp2p-containing subcomplex of 90S preribosome / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / rRNA modification / histone H2AQ104 methyltransferase activity / septum digestion after cytokinesis / tRNA re-export from nucleus ...RNA fragment catabolic process / rRNA 2'-O-methylation / t-UTP complex / Pwp2p-containing subcomplex of 90S preribosome / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / rRNA modification / histone H2AQ104 methyltransferase activity / septum digestion after cytokinesis / tRNA re-export from nucleus / snRNA binding / box C/D sno(s)RNA 3'-end processing / rRNA methyltransferase activity / endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / regulation of transcription by RNA polymerase I / RNA folding chaperone / endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / box C/D methylation guide snoRNP complex / rDNA heterochromatin / U4/U6 snRNP / positive regulation of rRNA processing / tRNA export from nucleus / sno(s)RNA-containing ribonucleoprotein complex / O-methyltransferase activity / protein localization to nucleolus / SUMOylation of RNA binding proteins / U4 snRNA binding / rRNA methylation / U4 snRNP / U3 snoRNA binding / snoRNA binding / precatalytic spliceosome / preribosome, small subunit precursor / Major pathway of rRNA processing in the nucleolus and cytosol / establishment of cell polarity / positive regulation of transcription by RNA polymerase I / spliceosomal complex assembly / 90S preribosome / U4/U6 x U5 tri-snRNP complex / endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / RNA endonuclease activity / Transferases; Transferring one-carbon groups; Methyltransferases / maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / spliceosomal complex / maturation of SSU-rRNA / small-subunit processome / mRNA splicing, via spliceosome / rRNA processing / peroxisome / ribosomal small subunit assembly / ribosomal small subunit biogenesis / tRNA binding / rRNA binding / mRNA binding / nucleolus / mitochondrion / RNA binding / nucleoplasm / identical protein binding / nucleus / cytoplasm Similarity search - Function | |||||||||
| Biological species | ![]() | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.3 Å | |||||||||
Authors | Hunziker, M. / Barandun, J. / Klinge, S. | |||||||||
| Funding support | United States, Switzerland, 2items
| |||||||||
Citation | Journal: Elife / Year: 2019Title: Conformational switches control early maturation of the eukaryotic small ribosomal subunit. Authors: Mirjam Hunziker / Jonas Barandun / Olga Buzovetsky / Caitlin Steckler / Henrik Molina / Sebastian Klinge / ![]() Abstract: Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent ...Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent from the mature ribosome. The subsequent co-transcriptional association of ribosome assembly factors with pre-ribosomal RNA results in the formation of the small subunit processome. Here we show that stable rRNA domains of the small ribosomal subunit can independently recruit their own biogenesis factors in vivo. The final assembly and compaction of the small subunit processome requires the presence of the 5' external transcribed spacer RNA and all ribosomal RNA domains. Additionally, our cryo-electron microscopy structure of the earliest nucleolar pre-ribosomal assembly - the 5' external transcribed spacer ribonucleoprotein - provides a mechanism for how conformational changes in multi-protein complexes can be employed to regulate the accessibility of binding sites and therefore define the chronology of maturation events during early stages of ribosome assembly. | |||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 6nd4.cif.gz | 1.8 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb6nd4.ent.gz | 1.2 MB | Display | PDB format |
| PDBx/mmJSON format | 6nd4.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/nd/6nd4 ftp://data.pdbj.org/pub/pdb/validation_reports/nd/6nd4 | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 0441MC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-RNA chain , 3 types, 3 molecules 012
| #1: RNA chain | Mass: 220317.000 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
|---|---|
| #2: RNA chain | Mass: 3727.073 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #3: RNA chain | Mass: 46932.852 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
+Protein , 24 types, 26 molecules HIJKLMNOPQRSTUWZADabcdefgl
-Protein/peptide , 1 types, 1 molecules x
| #28: Protein/peptide | Mass: 2060.531 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
|---|
-Details
| Sequence details | The complete sample sequence of 5'ETS rRNA is AUGCGAAAGCAGUUGAAGACAAGUUCGAAAAGAGUUUGGAAACGAAUUCG ...The complete sample sequence of 5'ETS rRNA is AUGCGAAAGC |
|---|
Movie
Controller
About Yorodumi





United States,
Switzerland, 2items
Citation
UCSF Chimera








PDBj

































