[English] 日本語
Yorodumi
- PDB-5nw5: Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from S... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5nw5
TitleCrystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA
Components
  • DNA (30-MER)
  • DNA (60-MER)
  • Telomere length regulator protein RIF1
KeywordsDNA BINDING PROTEIN / telomere maintenance / DNA double-strand break repair / irregular helical repeat / all-alpha fold
Function / homology
Function and homology information


negative regulation of mitotic DNA replication initiation from late origin / regulation of DNA stability / chromosome, telomeric repeat region / centromeric DNA binding / shelterin complex / DNA double-strand break processing / telomere capping / silent mating-type cassette heterochromatin formation / protein localization to chromosome, telomeric region / telomeric DNA binding ...negative regulation of mitotic DNA replication initiation from late origin / regulation of DNA stability / chromosome, telomeric repeat region / centromeric DNA binding / shelterin complex / DNA double-strand break processing / telomere capping / silent mating-type cassette heterochromatin formation / protein localization to chromosome, telomeric region / telomeric DNA binding / DNA replication origin binding / DNA replication initiation / RNA polymerase II core promoter sequence-specific DNA binding / negative regulation of DNA-templated DNA replication initiation / telomere maintenance / chromosome, telomeric region / nucleus
Similarity search - Function
Telomere-associated protein Rif1, N-terminal / Rap1-interacting factor 1 N terminal
Similarity search - Domain/homology
DNA / DNA (> 10) / Telomere length regulator protein RIF1
Similarity search - Component
Biological speciesSaccharomyces cerevisiae S288c (yeast)
synthetic construct (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 6.502 Å
AuthorsBunker, R.D. / Reinert, J.K. / Shi, T. / Thoma, N.H.
CitationJournal: Nat. Struct. Mol. Biol. / Year: 2017
Title: Rif1 maintains telomeres and mediates DNA repair by encasing DNA ends.
Authors: Mattarocci, S. / Reinert, J.K. / Bunker, R.D. / Fontana, G.A. / Shi, T. / Klein, D. / Cavadini, S. / Faty, M. / Shyian, M. / Hafner, L. / Shore, D. / Thoma, N.H. / Rass, U.
History
DepositionMay 5, 2017Deposition site: PDBE / Processing site: PDBE
Revision 1.0Jun 14, 2017Provider: repository / Type: Initial release
Revision 1.1Jun 28, 2017Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.name
Revision 1.2Jul 19, 2017Group: Database references / Category: citation
Item: _citation.country / _citation.journal_volume ..._citation.country / _citation.journal_volume / _citation.page_first / _citation.page_last
Revision 1.3Apr 3, 2019Group: Data collection / Source and taxonomy / Category: entity_src_gen / pdbx_seq_map_depositor_info
Item: _entity_src_gen.pdbx_host_org_cell_line / _pdbx_seq_map_depositor_info.one_letter_code_mod
Revision 1.4Jan 17, 2024Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Telomere length regulator protein RIF1
B: Telomere length regulator protein RIF1
C: DNA (60-MER)
D: DNA (30-MER)


Theoretical massNumber of molelcules
Total (without water)299,9954
Polymers299,9954
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: microscopy, The dimeric assembly of RIF1-NTD with DNA assigned to the ASU is supported negative-stain electron microscopy
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area6660 Å2
ΔGint-24 kcal/mol
Surface area117060 Å2
MethodPISA
Unit cell
Length a, b, c (Å)92.140, 169.800, 390.160
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number19
Space group name H-MP212121

-
Components

#1: Protein Telomere length regulator protein RIF1 / RAP1-interacting factor 1


Mass: 140781.562 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Saccharomyces cerevisiae S288c (yeast) / Gene: RIF1, YBR275C, YBR1743 / Cell line (production host): High Five / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: P29539
#2: DNA chain DNA (60-MER)


Mass: 9351.247 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in the most plausible orientation. Chain C construct sequence: ...Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in the most plausible orientation. Chain C construct sequence: ACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC.
Source: (synth.) synthetic construct (others)
#3: DNA chain DNA (30-MER)


Mass: 9080.827 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in most plausible orientation. Chain D construct sequence: TAGCAAGGCACTGGTAGAATTCGGCAGCGT.
Source: (synth.) synthetic construct (others)

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 5.09 Å3/Da / Density % sol: 75.82 %
Crystal growTemperature: 295 K / Method: vapor diffusion, sitting drop / pH: 7.4
Details: CRYSTAL GROWN BY DEHYDRATING 1 uL of PROTEIN-DNA MIXTURE (43.5 uM protein with 65 uM DNA) IN 50 mM HEPES PH 7.4, 310 mM NaCl, 1 mM TCEP over a reservoir containing 10 mM NiCl2, 100 mM Tris- ...Details: CRYSTAL GROWN BY DEHYDRATING 1 uL of PROTEIN-DNA MIXTURE (43.5 uM protein with 65 uM DNA) IN 50 mM HEPES PH 7.4, 310 mM NaCl, 1 mM TCEP over a reservoir containing 10 mM NiCl2, 100 mM Tris-HCl, pH 8, 20% (w/v) polyethylene glycol MME 2000

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: SLS / Beamline: X06DA / Wavelength: 0.91863 Å
DetectorType: DECTRIS PILATUS 2M-F / Detector: PIXEL / Date: Feb 26, 2013 / Details: DYNAMICALLY BENDABLE MIRROR
RadiationMonochromator: SI(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.91863 Å / Relative weight: 1
ReflectionResolution: 6.5→43.25 Å / Num. obs: 12703 / % possible obs: 99.6 % / Observed criterion σ(I): -3 / Redundancy: 11.9 % / Biso Wilson estimate: 388 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.342 / Rpim(I) all: 0.102 / Net I/σ(I): 8
Reflection shellResolution: 6.5→7.27 Å / Redundancy: 12.5 % / Rmerge(I) obs: 6.011 / Mean I/σ(I) obs: 0.5 / Num. unique obs: 3529 / CC1/2: 0.142 / Rpim(I) all: 1.757 / % possible all: 100

-
Processing

Software
NameVersionClassification
PHENIX(dev_2205: AMBER)refinement
XDSOct 15, 2015data reduction
Aimless0.5.23data scaling
PHASER2.7.6phasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 5NVR

5nvr


Resolution: 6.502→43.232 Å / SU ML: 1.11 / Cross valid method: THROUGHOUT / σ(F): 1.35 / Phase error: 32.41
Details: ANISOTROPICALLY TRUNCATED STRUCTURE FACTOR AMPLITUDES GENERATED BY STARANISO USED FOR REFINEMENT. FINAL REFINEMENT CARRIED OUT WITH HYBRID PHENIX/AMBER.
RfactorNum. reflection% reflectionSelection details
Rfree0.2765 578 6.51 %RANDOM SELECTION
Rwork0.2527 ---
obs0.2543 8877 70.22 %-
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å
Displacement parametersBiso mean: 331 Å2
Refinement stepCycle: LAST / Resolution: 6.502→43.232 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms17640 1224 0 0 18864
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.01519362
X-RAY DIFFRACTIONf_angle_d2.11526471
X-RAY DIFFRACTIONf_dihedral_angle_d23.2217383
X-RAY DIFFRACTIONf_chiral_restr0.1083094
X-RAY DIFFRACTIONf_plane_restr0.0173109
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
6.5023-7.1540.4208590.3964650X-RAY DIFFRACTION23
7.154-8.18310.39761200.33481878X-RAY DIFFRACTION65
8.1831-10.28680.27421830.24982699X-RAY DIFFRACTION91
10.2868-43.23270.24312160.22863072X-RAY DIFFRACTION100

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more