[English] 日本語

- PDB-5nw5: Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from S... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 5nw5 | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA | ||||||
![]() |
| ||||||
![]() | DNA BINDING PROTEIN / telomere maintenance / DNA double-strand break repair / irregular helical repeat / all-alpha fold | ||||||
Function / homology | ![]() negative regulation of mitotic DNA replication initiation from late origin / regulation of DNA stability / chromosome, telomeric repeat region / shelterin complex / centromeric DNA binding / DNA double-strand break processing / telomere capping / silent mating-type cassette heterochromatin formation / protein localization to chromosome, telomeric region / telomeric DNA binding ...negative regulation of mitotic DNA replication initiation from late origin / regulation of DNA stability / chromosome, telomeric repeat region / shelterin complex / centromeric DNA binding / DNA double-strand break processing / telomere capping / silent mating-type cassette heterochromatin formation / protein localization to chromosome, telomeric region / telomeric DNA binding / DNA replication origin binding / DNA replication initiation / RNA polymerase II core promoter sequence-specific DNA binding / negative regulation of DNA-templated DNA replication initiation / telomere maintenance / chromosome, telomeric region / nucleus Similarity search - Function | ||||||
Biological species | ![]() ![]() synthetic construct (others) | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Bunker, R.D. / Reinert, J.K. / Shi, T. / Thoma, N.H. | ||||||
![]() | ![]() Title: Rif1 maintains telomeres and mediates DNA repair by encasing DNA ends. Authors: Mattarocci, S. / Reinert, J.K. / Bunker, R.D. / Fontana, G.A. / Shi, T. / Klein, D. / Cavadini, S. / Faty, M. / Shyian, M. / Hafner, L. / Shore, D. / Thoma, N.H. / Rass, U. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 795 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 629.8 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 436 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 475.1 KB | Display | |
Data in XML | ![]() | 41.2 KB | Display | |
Data in CIF | ![]() | 63.7 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 5nvrSC S: Starting model for refinement C: citing same article ( |
---|---|
Similar structure data | |
Experimental dataset #1 | Data reference: ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 140781.562 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() #2: DNA chain | | Mass: 9351.247 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in the most plausible orientation. Chain C construct sequence: ...Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in the most plausible orientation. Chain C construct sequence: ACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC. Source: (synth.) synthetic construct (others) #3: DNA chain | | Mass: 9080.827 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in most plausible orientation. Chain D construct sequence: TAGCAAGGCACTGGTAGAATTCGGCAGCGT. Source: (synth.) synthetic construct (others) |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 5.09 Å3/Da / Density % sol: 75.82 % |
---|---|
Crystal grow | Temperature: 295 K / Method: vapor diffusion, sitting drop / pH: 7.4 Details: CRYSTAL GROWN BY DEHYDRATING 1 uL of PROTEIN-DNA MIXTURE (43.5 uM protein with 65 uM DNA) IN 50 mM HEPES PH 7.4, 310 mM NaCl, 1 mM TCEP over a reservoir containing 10 mM NiCl2, 100 mM Tris- ...Details: CRYSTAL GROWN BY DEHYDRATING 1 uL of PROTEIN-DNA MIXTURE (43.5 uM protein with 65 uM DNA) IN 50 mM HEPES PH 7.4, 310 mM NaCl, 1 mM TCEP over a reservoir containing 10 mM NiCl2, 100 mM Tris-HCl, pH 8, 20% (w/v) polyethylene glycol MME 2000 |
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: DECTRIS PILATUS 2M-F / Detector: PIXEL / Date: Feb 26, 2013 / Details: DYNAMICALLY BENDABLE MIRROR |
Radiation | Monochromator: SI(111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 0.91863 Å / Relative weight: 1 |
Reflection | Resolution: 6.5→43.25 Å / Num. obs: 12703 / % possible obs: 99.6 % / Observed criterion σ(I): -3 / Redundancy: 11.9 % / Biso Wilson estimate: 388 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.342 / Rpim(I) all: 0.102 / Net I/σ(I): 8 |
Reflection shell | Resolution: 6.5→7.27 Å / Redundancy: 12.5 % / Rmerge(I) obs: 6.011 / Mean I/σ(I) obs: 0.5 / Num. unique obs: 3529 / CC1/2: 0.142 / Rpim(I) all: 1.757 / % possible all: 100 |
-
Processing
Software |
| |||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: 5NVR Resolution: 6.502→43.232 Å / SU ML: 1.11 / Cross valid method: THROUGHOUT / σ(F): 1.35 / Phase error: 32.41 Details: ANISOTROPICALLY TRUNCATED STRUCTURE FACTOR AMPLITUDES GENERATED BY STARANISO USED FOR REFINEMENT. FINAL REFINEMENT CARRIED OUT WITH HYBRID PHENIX/AMBER.
| |||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å | |||||||||||||||||||||||||||||||||||
Displacement parameters | Biso mean: 331 Å2 | |||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 6.502→43.232 Å
| |||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||
LS refinement shell |
|