[English] 日本語
Yorodumi
- PDB-4v7c: Structure of the Ribosome with Elongation Factor G Trapped in the... -

+
Open data


ID or keywords:

Loading...

no data

-
Basic information

Entry
Database: PDB / ID: 4v7c
TitleStructure of the Ribosome with Elongation Factor G Trapped in the Pre-Translocation State (pre-translocation 70S*tRNA structure)
Components
  • (30S ribosomal protein ...) x 20
  • (50S ribosomal protein ...) x 31
  • 16S ribosomal RNA
  • 23S ribosomal RNA
  • 5S ribosomal RNA
  • mRNAMessenger RNA
  • tRNATransfer RNA
  • viomycin
KeywordsTRANSLATION / translation / EF-G / single particle analysis / pre-translocation translation complex / viomycin
Function / homologyRibosomal protein L4 domain superfamily / Ribosomal protein L20, C-terminal / Ribosomal protein L17 superfamily / Ribosomal L18e/L15P superfamily / L21-like superfamily / Ribosomal protein L29/L35 superfamily / Ribosomal protein S8 superfamily / Ribosomal protein S6 superfamily / Ribosomal protein L36 superfamily / L28p-like ...Ribosomal protein L4 domain superfamily / Ribosomal protein L20, C-terminal / Ribosomal protein L17 superfamily / Ribosomal L18e/L15P superfamily / L21-like superfamily / Ribosomal protein L29/L35 superfamily / Ribosomal protein S8 superfamily / Ribosomal protein S6 superfamily / Ribosomal protein L36 superfamily / L28p-like / Ribosomal protein S3, C-terminal domain superfamily / Ribosomal protein L5, N-terminal / Ribosomal protein L5, C-terminal / Ribosomal protein L15 / Ribosomal protein L25 / Ribosomal protein L21-like / Ribosomal protein L1/ribosomal biogenesis protein / Ribosomal protein S10 domain / 30s ribosomal protein S13, C-terminal / Ribosomal protein L22/L17 superfamily / Ribosomal protein S20 superfamily / Ribosomal protein S16 domain superfamily / Ribosomal protein L10e/L16 superfamily / Ribosomal protein L19 superfamily / Ribosomal protein L33 superfamily / Ribosomal protein S21 superfamily / Ribosomal protein L35 superfamily / Ribosomal protein L28/L24 superfamily / RNA-binding S4 domain superfamily / Ribosomal protein S11 superfamily / Ribosomal protein L9, N-terminal domain superfamily / Ribosomal protein L30, ferredoxin-like fold domain superfamily / Ribosomal protein L11, C-terminal domain superfamily / Ribosomal protein L13 superfamily / Ribosomal protein S18 superfamily / Ribosomal protein L14 superfamily / Ribosomal protein S10 domain superfamily / Ribosomal protein S7 domain superfamily / Ribosomal protein L11/L12, N-terminal domain superfamily / Ribosomal protein L9, C-terminal domain superfamily / Ribosomal protein L6, alpha-beta domain superfamily / Ribosomal protein L28/L24 / Ribosomal protein S7 domain / Ribosomal protein S12/S23 / Ribosomal protein L9, C-terminal / Ribosomal protein L11, N-terminal / Ribosomal protein L11, C-terminal / Ribosomal protein S7, conserved site / Ribosomal protein L9, bacteria/chloroplast / Ribosomal protein S16, conserved site / Ribosomal protein S9, conserved site / Ribosomal protein S5 domain 2-type fold / Ribosomal protein L9, N-terminal / Ribosomal protein L25/Gln-tRNA synthetase, N-terminal / Ribosomal protein L16, conserved site / Ribosomal protein L25, short-form / Ribosomal protein L6, alpha-beta domain / 30S ribosomal protein S17 / Ribosomal protein S11, bacterial-type / Ribosomal protein S13, bacterial-type / Ribosomal protein S17, conserved site / Ribosomal protein L14P, conserved site / Ribosomal protein L3, bacterial/organelle-type / Ribosomal protein L11, conserved site / Ribosomal protein S6, plastid/chloroplast / Ribosomal protein L1-like / Ribosomal protein S4/S9 / Ribosomal protein L1, conserved site / Ribosomal protein S2, flavodoxin-like domain superfamily / Ribosomal protein S19, superfamily / Ribosomal protein L13, conserved site / Ribosomal protein S14, bacterial/plastid / Ribosomal protein S9, bacterial/plastid / Ribosomal protein L10 / Ribosomal protein L5 domain superfamily / Ribosomal protein L2, conserved site / Ribosomal protein S6, conserved site / Ribosomal protein L2, C-terminal / Ribosomal Proteins L2, RNA binding domain / Ribosomal protein L35 / Ribosomal protein L18e/L15P / Ribosomal protein L34, conserved site / Ribosomal protein S19 conserved site / Ribosomal protein L5, bacterial-type / Ribosomal protein L5, conserved site / Ribosomal protein S4/S9 N-terminal domain / Ribosomal protein S7p/S5e / Ribosomal protein L16 signature 2. / KH domain / Ribosomal protein S12 signature. / Ribosomal protein S11 signature. / Ribosomal protein S8 signature. / Ribosomal protein S7 signature. / Ribosomal protein L23 signature. / Ribosomal protein L14 signature. / Ribosomal proteins 50S L24/mitochondrial 39S L24 / Ribosomal protein L9, C-terminal domain / Ribosomal protein S18 signature. / Ribosomal Proteins L2, C-terminal domain / Ribosomal protein L11, N-terminal domain
Function and homology information
Specimen sourceEscherichia coli (E. coli)
Streptomyces (bacteria)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / 7.6 Å resolution
AuthorsBrilot, A.F. / Korostelev, A.A. / Ermolenko, D.N. / Grigorieff, N.
CitationJournal: Proc. Natl. Acad. Sci. U.S.A. / Year: 2013
Title: Structure of the ribosome with elongation factor G trapped in the pretranslocation state.
Authors: Axel F Brilot / Andrei A Korostelev / Dmitri N Ermolenko / Nikolaus Grigorieff
Validation Report
SummaryFull reportAbout validation report
DateDeposition: Nov 20, 2013 / Release: Jul 9, 2014
RevisionDateData content typeGroupCategoryItemProviderType
1.0Jul 9, 2014Structure modelrepositoryInitial release
1.1Dec 10, 2014Structure modelOther
1.2Apr 15, 2015Structure modelOther
1.3Jul 18, 2018Structure modelData collectionem_software_em_software.image_processing_id / _em_software.name

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-5799
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
AA: 16S ribosomal RNA
AB: 30S ribosomal protein S2
AC: 30S ribosomal protein S3
AD: 30S ribosomal protein S4
AE: 30S ribosomal protein S5
AF: 30S ribosomal protein S6
AG: 30S ribosomal protein S7
AH: 30S ribosomal protein S8
AI: 30S ribosomal protein S9
AJ: 30S ribosomal protein S10
AK: 30S ribosomal protein S11
AL: 30S ribosomal protein S12
AM: 30S ribosomal protein S13
AN: 30S ribosomal protein S14
AO: 30S ribosomal protein S15
AP: 30S ribosomal protein S16
AQ: 30S ribosomal protein S17
AR: 30S ribosomal protein S18
AS: 30S ribosomal protein S19
AT: 30S ribosomal protein S20
AU: 30S ribosomal protein S21
AV: tRNA
AW: tRNA
AX: mRNA
AY: viomycin
BA: 23S ribosomal RNA
BB: 5S ribosomal RNA
BC: 50S ribosomal protein L1
BD: 50S ribosomal protein L2
BE: 50S ribosomal protein L3
BF: 50S ribosomal protein L4
BG: 50S ribosomal protein L5
BH: 50S ribosomal protein L6
BI: 50S ribosomal protein L9
BJ: 50S ribosomal protein L10
BK: 50S ribosomal protein L11
BL: 50S ribosomal protein L13
BM: 50S ribosomal protein L14
BN: 50S ribosomal protein L15
BO: 50S ribosomal protein L16
BP: 50S ribosomal protein L17
BQ: 50S ribosomal protein L18
BR: 50S ribosomal protein L19
BS: 50S ribosomal protein L20
BT: 50S ribosomal protein L21
BU: 50S ribosomal protein L22
BV: 50S ribosomal protein L23
BW: 50S ribosomal protein L24
BX: 50S ribosomal protein L25
BY: 50S ribosomal protein L27
BZ: 50S ribosomal protein L28
B1: 50S ribosomal protein L29
B2: 50S ribosomal protein L30
B3: 50S ribosomal protein L32
B4: 50S ribosomal protein L33
B5: 50S ribosomal protein L34
B6: 50S ribosomal protein L35
B7: 50S ribosomal protein L36
hetero molecules


Theoretical massNumber of molelcules
Total (without water)2,239,89359
Polyers2,239,82858
Non-polymers651
Water0
1


  • idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
RNA chain , 5 types, 6 molecules AAAVAWAXBABB

#1: RNA chain 16S ribosomal RNA /


Mass: 499690.031 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: J01695.2
#22: RNA chain tRNA / Transfer RNA


Mass: 24485.539 Da / Num. of mol.: 2 / Fragment: SEE REMARK 999 / Source: (natural) Escherichia coli (E. coli) / Strain: K-12 / References: GenBank: AP009048.1
#23: RNA chain mRNA / Messenger RNA


Mass: 5781.499 Da / Num. of mol.: 1 / Fragment: SEE REMARK 999
#25: RNA chain 23S ribosomal RNA /


Mass: 941306.188 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: 33357927
#26: RNA chain 5S ribosomal RNA /


Mass: 38483.926 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: CP000948.1

+
30S ribosomal protein ... , 20 types, 20 molecules ABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAU

#2: Protein/peptide 30S ribosomal protein S2 /


Mass: 26650.475 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V0
#3: Protein/peptide 30S ribosomal protein S3 /


Mass: 25900.117 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V3
#4: Protein/peptide 30S ribosomal protein S4 /


Mass: 23383.002 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V8
#5: Protein/peptide 30S ribosomal protein S5 /


Mass: 17498.203 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W1
#6: Protein/peptide 30S ribosomal protein S6 /


Mass: 15211.058 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02358
#7: Protein/peptide 30S ribosomal protein S7 /


Mass: 19923.959 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02359
#8: Protein/peptide 30S ribosomal protein S8 /


Mass: 14015.361 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W7
#9: Protein/peptide 30S ribosomal protein S9 /


Mass: 14755.074 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7X3
#10: Protein/peptide 30S ribosomal protein S10 /


Mass: 11755.597 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R5
#11: Protein/peptide 30S ribosomal protein S11 /


Mass: 13739.778 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R9
#12: Protein/peptide 30S ribosomal protein S12 /


Mass: 13636.961 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S3
#13: Protein/peptide 30S ribosomal protein S13 /


Mass: 12997.271 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S9
#14: Protein/peptide 30S ribosomal protein S14 /


Mass: 11475.364 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG59
#15: Protein/peptide 30S ribosomal protein S15 /


Mass: 10159.621 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ4
#16: Protein/peptide 30S ribosomal protein S16 /


Mass: 9207.572 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T3
#17: Protein/peptide 30S ribosomal protein S17 /


Mass: 9593.296 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG63
#18: Protein/peptide 30S ribosomal protein S18 /


Mass: 8874.276 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T7
#19: Protein/peptide 30S ribosomal protein S19 /


Mass: 10324.160 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U3
#20: Protein/peptide 30S ribosomal protein S20 /


Mass: 9577.268 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U7
#21: Protein/peptide 30S ribosomal protein S21 /


Mass: 8392.844 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68679

+
50S ribosomal protein ... , 31 types, 31 molecules BCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZB1B2B3B4B5B6B7

#27: Protein/peptide 50S ribosomal protein L1 /


Mass: 24634.465 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L0
#28: Protein/peptide 50S ribosomal protein L2 /


Mass: 29792.424 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60422
#29: Protein/peptide 50S ribosomal protein L3 /


Mass: 22277.535 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60438
#30: Protein/peptide 50S ribosomal protein L4 /


Mass: 22121.566 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60723
#31: Protein/peptide 50S ribosomal protein L5 /


Mass: 20202.416 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P62399
#32: Protein/peptide 50S ribosomal protein L6 /


Mass: 18801.598 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG55
#33: Protein/peptide 50S ribosomal protein L9 /


Mass: 15789.020 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R1
#34: Protein/peptide 50S ribosomal protein L10 /


Mass: 17736.596 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J3
#35: Protein/peptide 50S ribosomal protein L11 /


Mass: 14763.165 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J7
#36: Protein/peptide 50S ribosomal protein L13 /


Mass: 16050.606 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AA10
#37: Protein/peptide 50S ribosomal protein L14 /


Mass: 13565.067 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY3
#38: Protein/peptide 50S ribosomal protein L15 /


Mass: 15008.471 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02413
#39: Protein/peptide 50S ribosomal protein L16 /


Mass: 15312.269 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY7
#40: Protein/peptide 50S ribosomal protein L17 /


Mass: 14393.657 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG44
#41: Protein/peptide 50S ribosomal protein L18 /


Mass: 12794.668 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0C018
#42: Protein/peptide 50S ribosomal protein L19 /


Mass: 13028.082 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7K6
#43: Protein/peptide 50S ribosomal protein L20 /


Mass: 13396.828 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L3
#44: Protein/peptide 50S ribosomal protein L21 /


Mass: 11586.374 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG48
#45: Protein/peptide 50S ribosomal protein L22 /


Mass: 12253.359 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P61175
#46: Protein/peptide 50S ribosomal protein L23 /


Mass: 11222.160 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ0
#47: Protein/peptide 50S ribosomal protein L24 /


Mass: 11208.054 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60624
#48: Protein/peptide 50S ribosomal protein L25 /


Mass: 10713.465 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68919
#49: Protein/peptide 50S ribosomal protein L27 /


Mass: 9015.344 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L8
#50: Protein/peptide 50S ribosomal protein L28 /


Mass: 8896.354 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M2
#51: Protein/peptide 50S ribosomal protein L29 /


Mass: 7286.464 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M6
#52: Protein/peptide 50S ribosomal protein L30 /


Mass: 6423.625 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG51
#53: Protein/peptide 50S ribosomal protein L32 /


Mass: 6332.249 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N4
#54: Protein/peptide 50S ribosomal protein L33 /


Mass: 6257.436 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N9
#55: Protein/peptide 50S ribosomal protein L34 /


Mass: 5397.463 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7P5
#56: Protein/peptide 50S ribosomal protein L35 /


Mass: 7181.835 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q1
#57: Protein/peptide 50S ribosomal protein L36 /


Mass: 4377.390 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q6

-
Protein/peptide / Non-polymers , 2 types, 2 molecules AY

#24: Protein/peptide viomycin /


Mass: 703.707 Da / Num. of mol.: 1 / Source: (synth.) Streptomyces (bacteria) / References: NOR: NOR00633

about BIRD dictionary

PRD-IDPRD_000226
ClassAntibiotic
NameViomycin
TypeOligopeptide
#58: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Formula: Zn / Zinc

-
Details

Sequence detailsTHE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS ...THE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS STUDY ARE MODELED AS TRNA-PHE AND AGGAGGUAAAAUUCUUCA, RESPECTIVELY, ACCORDING TO THE SEQUENCES IN THE CRYSTAL STRUCTURE USED AS A STARTING STRUCTURAL MODEL (PDB ENTRY 4GD1).

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / Reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeDetailsParent ID
1Pre-translocation ribosome bound to A/P, P/E hybrid state tRNARIBOSOMESample was monodisperse.0
270S ribosomeRIBOSOME1
3Transfer RNA1
4Messenger RNA1
Molecular weightValue: 3 MDa / Experimental value: NO
Buffer solutionName: Polymix buffer
Details: 10 mM HEPES-KOH, 5 mM MgCl2, 90 mM NH4Cl, 2 mM spermidine, 0.1 mM spermine, 6 mM BME, 0.5 mM viomycin, 0.5 mM GTP, 0.5 mM fusidic acid
pH: 7.6
SpecimenConc.: 0.4 / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportDetails: C-flat 1.2/1.3 holey carbon 400 mesh copper grid, glow discharged with a current of -20 mA for 45 seconds in an EMITECH K100X glow discharge unit
VitrificationInstrument: FEI VITROBOT MARK II / Cryogen name: ETHANE / Humidity: 95 %
Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.
Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyMicroscope model: FEI TITAN KRIOS / Date: Nov 2, 2012
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELDBright-field microscopy / Nominal magnification: 133333 / Calibrated magnification: 134615 / Nominal defocus max: 6950 / Nominal defocus min: 1150 / Cs: 0.01 / Astigmatism: Automatically corrected using FEI software / Camera length: 0
Specimen holderSpecimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 30 / Film or detector model: FEI FALCON I (4k x 4k)
Image scansNumber digital images: 13341
RadiationDiffraction protocol: SINGLE WAVELENGTH / Monochromatic or laue m l: M / Scattering type: x-ray
Radiation wavelengthRelative weight: 1

-
Processing

EM software
IDNameVersionCategory
1CTFFIND3CTF correction
2CNSmodel fitting
3UCSF Chimeramodel fitting
4EMAN23D reconstruction
5FREALIGN3D reconstruction
6IMAGIC3D reconstruction
7RSAMPLE3D reconstruction
CTF correctionDetails: CTFFIND3, FREALIGN per micrograph
SymmetryPoint symmetry: C1
3D reconstructionMethod: Projection Matching / Resolution: 7.6 / Resolution method: FSC 0.143 CUT-OFF / Number of particles: 85115 / Nominal pixel size: 1.05 / Actual pixel size: 1.04
Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification performed by Frealign) (Single particle--Applied symmetry: C1)
Symmetry type: POINT
Atomic model buildingDetails: REFINEMENT PROTOCOL--rigid body DETAILS--Chain Y not used in refinement
Ref protocol: RIGID BODY FIT / Ref space: REAL / Target criteria: Cross-correlation
Atomic model buildingPDB-ID: 4GD1
Number of atoms included #LASTProtein: 18591 / Nucleic acid: 36622 / Ligand: 0 / Solvent: 0 / Total: 55213

+
About Yorodumi

-
News

-
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force. (see PDBe EMDB page)
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.: Q: What is "EMD"? / ID/Accession-code notation in Yorodumi/EM Navigator

External links: EMDB at EBI / Contact to PDBj

-
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary. This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated. See below links for details.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software). Now, EM Navigator and Yorodumi are based on the updated data.

External links: wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

+
Jun 16, 2017. Omokage search with filter

Omokage search with filter

  • Result of Omokage search can be filtered by keywords and the database types

Related info.: Omokage search

+
Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi

+
Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi

Read more

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more