[English] 日本語
Yorodumi
- PDB-4v7c: Structure of the Ribosome with Elongation Factor G Trapped in the... -

+
Open data


ID or keywords:

Loading...

no data

-
Basic information

Entry
Database: PDB / ID: 4v7c
TitleStructure of the Ribosome with Elongation Factor G Trapped in the Pre-Translocation State (pre-translocation 70S*tRNA structure)
Components
  • (30S ribosomal protein ...) x 20
  • (50S ribosomal protein ...) x 31
  • 16S ribosomal RNA
  • 23S ribosomal RNA
  • 5S ribosomal RNA
  • mRNAMessenger RNA
  • tRNATransfer RNA
  • viomycin
KeywordsTRANSLATION / translation / EF-G / single particle analysis / pre-translocation translation complex / viomycin
Function / homologyRibosomal protein L4 domain superfamily / Ribosomal protein L36 superfamily / Ribosomal protein L22/L17 superfamily / Ribosomal protein L17 superfamily / Ribosomal L18e/L15P superfamily / L21-like superfamily / Ribosomal protein L29/L35 superfamily / Ribosomal protein S8 superfamily / Ribosomal protein S6 superfamily / Ribosomal protein L20, C-terminal ...Ribosomal protein L4 domain superfamily / Ribosomal protein L36 superfamily / Ribosomal protein L22/L17 superfamily / Ribosomal protein L17 superfamily / Ribosomal L18e/L15P superfamily / L21-like superfamily / Ribosomal protein L29/L35 superfamily / Ribosomal protein S8 superfamily / Ribosomal protein S6 superfamily / Ribosomal protein L20, C-terminal / Ribosomal protein S20 superfamily / L28p-like / Ribosomal protein L5, N-terminal / Ribosomal protein L5, C-terminal / Ribosomal protein L15 / Ribosomal protein L25 / Ribosomal protein L21-like / Ribosomal protein L1/ribosomal biogenesis protein / Ribosomal protein S10 domain / Ribosomal protein S3, C-terminal domain superfamily / Ribosomal protein L11, C-terminal domain superfamily / Ribosomal protein L28/L24 / Ribosomal protein L9, N-terminal domain superfamily / Ribosomal protein S4/S9 N-terminal domain / Ribosomal protein L19 superfamily / Ribosomal protein L33 superfamily / Ribosomal protein S21 superfamily / Ribosomal protein L35 superfamily / Ribosomal protein L28/L24 superfamily / RNA-binding S4 domain superfamily / Ribosomal protein S11 superfamily / Ribosomal protein L10e/L16 superfamily / Ribosomal protein L6, alpha-beta domain superfamily / Ribosomal protein L30, ferredoxin-like fold domain superfamily / Ribosomal protein L13 superfamily / Ribosomal protein S18 superfamily / Ribosomal protein L14 superfamily / Ribosomal protein S10 domain superfamily / Ribosomal protein S7 domain superfamily / Ribosomal protein L11/L12, N-terminal domain superfamily / Ribosomal protein L9, C-terminal domain superfamily / 30s ribosomal protein S13, C-terminal / Ribosomal protein S16 domain superfamily / Ribosomal protein S7p/S5e / Ribosomal protein L9, N-terminal / Ribosomal protein L11, conserved site / Ribosomal protein L11, N-terminal / Ribosomal protein L11, C-terminal / Ribosomal protein S7, conserved site / Ribosomal protein L9, bacteria/chloroplast / Ribosomal protein S16, conserved site / Ribosomal protein S9, conserved site / Ribosomal protein S5 domain 2-type fold / Ribosomal protein L9, C-terminal / Ribosomal protein S6, plastid/chloroplast / Ribosomal protein L25/Gln-tRNA synthetase, N-terminal / Ribosomal protein L25, short-form / Ribosomal protein L6, alpha-beta domain / 30S ribosomal protein S17 / Ribosomal protein S11, bacterial-type / Ribosomal protein S13, bacterial-type / Ribosomal protein S17, conserved site / Ribosomal protein L14P, conserved site / Ribosomal protein L16, conserved site / Ribosomal protein S6, conserved site / Ribosomal protein S7 domain / Ribosomal protein L5 domain superfamily / Ribosomal protein L1-like / Ribosomal protein L1, conserved site / Ribosomal protein S2, flavodoxin-like domain superfamily / Ribosomal protein S19, superfamily / Ribosomal protein L13, conserved site / Ribosomal protein S14, bacterial/plastid / Ribosomal protein S9, bacterial/plastid / Ribosomal protein L10 / Ribosomal protein S4/S9 / Ribosomal protein L5, conserved site / Ribosomal protein L2, conserved site / Ribosomal protein L2, C-terminal / Ribosomal Proteins L2, RNA binding domain / Ribosomal protein L35 / Ribosomal protein L18e/L15P / Ribosomal protein L34, conserved site / Ribosomal protein S19 conserved site / Ribosomal protein L5, bacterial-type / Ribosomal protein S12/S23 / Ribosomal Proteins L2, RNA binding domain / Ribosomal protein L3, conserved site / Ribosomal proteins 50S L24/mitochondrial 39S L24 / Ribosomal protein S17 signature. / Ribosomal protein S12 signature. / Ribosomal protein S11 signature. / Ribosomal protein S8 signature. / Ribosomal protein S7 signature. / Ribosomal protein L23 signature. / Ribosomal protein L14 signature. / KH domain / Ribosomal protein S19 signature. / Ribosomal protein L9, C-terminal domain / Ribosomal Proteins L2, C-terminal domain
Function and homology information
Specimen sourceEscherichia coli (E. coli)
Streptomyces (bacteria)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / 7.6 Å resolution
AuthorsBrilot, A.F. / Korostelev, A.A. / Ermolenko, D.N. / Grigorieff, N.
CitationJournal: Proc. Natl. Acad. Sci. U.S.A. / Year: 2013
Title: Structure of the ribosome with elongation factor G trapped in the pretranslocation state.
Authors: Axel F Brilot / Andrei A Korostelev / Dmitri N Ermolenko / Nikolaus Grigorieff
Validation Report
SummaryFull reportAbout validation report
DateDeposition: Nov 20, 2013 / Release: Jul 9, 2014
RevisionDateData content typeGroupCategoryItemProviderType
1.0Jul 9, 2014Structure modelrepositoryInitial release
1.1Dec 10, 2014Structure modelOther
1.2Apr 15, 2015Structure modelOther
1.3Jul 18, 2018Structure modelData collectionem_software_em_software.image_processing_id / _em_software.name

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-5799
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
AA: 16S ribosomal RNA
AB: 30S ribosomal protein S2
AC: 30S ribosomal protein S3
AD: 30S ribosomal protein S4
AE: 30S ribosomal protein S5
AF: 30S ribosomal protein S6
AG: 30S ribosomal protein S7
AH: 30S ribosomal protein S8
AI: 30S ribosomal protein S9
AJ: 30S ribosomal protein S10
AK: 30S ribosomal protein S11
AL: 30S ribosomal protein S12
AM: 30S ribosomal protein S13
AN: 30S ribosomal protein S14
AO: 30S ribosomal protein S15
AP: 30S ribosomal protein S16
AQ: 30S ribosomal protein S17
AR: 30S ribosomal protein S18
AS: 30S ribosomal protein S19
AT: 30S ribosomal protein S20
AU: 30S ribosomal protein S21
AV: tRNA
AW: tRNA
AX: mRNA
AY: viomycin
BA: 23S ribosomal RNA
BB: 5S ribosomal RNA
BC: 50S ribosomal protein L1
BD: 50S ribosomal protein L2
BE: 50S ribosomal protein L3
BF: 50S ribosomal protein L4
BG: 50S ribosomal protein L5
BH: 50S ribosomal protein L6
BI: 50S ribosomal protein L9
BJ: 50S ribosomal protein L10
BK: 50S ribosomal protein L11
BL: 50S ribosomal protein L13
BM: 50S ribosomal protein L14
BN: 50S ribosomal protein L15
BO: 50S ribosomal protein L16
BP: 50S ribosomal protein L17
BQ: 50S ribosomal protein L18
BR: 50S ribosomal protein L19
BS: 50S ribosomal protein L20
BT: 50S ribosomal protein L21
BU: 50S ribosomal protein L22
BV: 50S ribosomal protein L23
BW: 50S ribosomal protein L24
BX: 50S ribosomal protein L25
BY: 50S ribosomal protein L27
BZ: 50S ribosomal protein L28
B1: 50S ribosomal protein L29
B2: 50S ribosomal protein L30
B3: 50S ribosomal protein L32
B4: 50S ribosomal protein L33
B5: 50S ribosomal protein L34
B6: 50S ribosomal protein L35
B7: 50S ribosomal protein L36
hetero molecules


Theoretical massNumber of molelcules
Total (without water)2,239,89359
Polyers2,239,82858
Non-polymers651
Water0
1


  • idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
RNA chain , 5 types, 6 molecules AAAVAWAXBABB

#1: RNA chain 16S ribosomal RNA /


Mass: 499690.031 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: J01695.2
#22: RNA chain tRNA / Transfer RNA


Mass: 24485.539 Da / Num. of mol.: 2 / Fragment: SEE REMARK 999 / Source: (natural) Escherichia coli (E. coli) / Strain: K-12 / References: GenBank: AP009048.1
#23: RNA chain mRNA / Messenger RNA


Mass: 5781.499 Da / Num. of mol.: 1 / Fragment: SEE REMARK 999
#25: RNA chain 23S ribosomal RNA /


Mass: 941306.188 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: 33357927
#26: RNA chain 5S ribosomal RNA /


Mass: 38483.926 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: CP000948.1

+
30S ribosomal protein ... , 20 types, 20 molecules ABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAU

#2: Protein/peptide 30S ribosomal protein S2 /


Mass: 26650.475 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V0
#3: Protein/peptide 30S ribosomal protein S3 /


Mass: 25900.117 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V3
#4: Protein/peptide 30S ribosomal protein S4 /


Mass: 23383.002 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V8
#5: Protein/peptide 30S ribosomal protein S5 /


Mass: 17498.203 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W1
#6: Protein/peptide 30S ribosomal protein S6 /


Mass: 15211.058 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02358
#7: Protein/peptide 30S ribosomal protein S7 /


Mass: 19923.959 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02359
#8: Protein/peptide 30S ribosomal protein S8 /


Mass: 14015.361 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W7
#9: Protein/peptide 30S ribosomal protein S9 /


Mass: 14755.074 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7X3
#10: Protein/peptide 30S ribosomal protein S10 /


Mass: 11755.597 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R5
#11: Protein/peptide 30S ribosomal protein S11 /


Mass: 13739.778 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R9
#12: Protein/peptide 30S ribosomal protein S12 /


Mass: 13636.961 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S3
#13: Protein/peptide 30S ribosomal protein S13 /


Mass: 12997.271 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S9
#14: Protein/peptide 30S ribosomal protein S14 /


Mass: 11475.364 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG59
#15: Protein/peptide 30S ribosomal protein S15 /


Mass: 10159.621 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ4
#16: Protein/peptide 30S ribosomal protein S16 /


Mass: 9207.572 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T3
#17: Protein/peptide 30S ribosomal protein S17 /


Mass: 9593.296 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG63
#18: Protein/peptide 30S ribosomal protein S18 /


Mass: 8874.276 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T7
#19: Protein/peptide 30S ribosomal protein S19 /


Mass: 10324.160 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U3
#20: Protein/peptide 30S ribosomal protein S20 /


Mass: 9577.268 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U7
#21: Protein/peptide 30S ribosomal protein S21 /


Mass: 8392.844 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68679

+
50S ribosomal protein ... , 31 types, 31 molecules BCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZB1B2B3B4B5B6B7

#27: Protein/peptide 50S ribosomal protein L1 /


Mass: 24634.465 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L0
#28: Protein/peptide 50S ribosomal protein L2 /


Mass: 29792.424 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60422
#29: Protein/peptide 50S ribosomal protein L3 /


Mass: 22277.535 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60438
#30: Protein/peptide 50S ribosomal protein L4 /


Mass: 22121.566 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60723
#31: Protein/peptide 50S ribosomal protein L5 /


Mass: 20202.416 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P62399
#32: Protein/peptide 50S ribosomal protein L6 /


Mass: 18801.598 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG55
#33: Protein/peptide 50S ribosomal protein L9 /


Mass: 15789.020 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R1
#34: Protein/peptide 50S ribosomal protein L10 /


Mass: 17736.596 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J3
#35: Protein/peptide 50S ribosomal protein L11 /


Mass: 14763.165 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J7
#36: Protein/peptide 50S ribosomal protein L13 /


Mass: 16050.606 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AA10
#37: Protein/peptide 50S ribosomal protein L14 /


Mass: 13565.067 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY3
#38: Protein/peptide 50S ribosomal protein L15 /


Mass: 15008.471 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02413
#39: Protein/peptide 50S ribosomal protein L16 /


Mass: 15312.269 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY7
#40: Protein/peptide 50S ribosomal protein L17 /


Mass: 14393.657 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG44
#41: Protein/peptide 50S ribosomal protein L18 /


Mass: 12794.668 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0C018
#42: Protein/peptide 50S ribosomal protein L19 /


Mass: 13028.082 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7K6
#43: Protein/peptide 50S ribosomal protein L20 /


Mass: 13396.828 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L3
#44: Protein/peptide 50S ribosomal protein L21 /


Mass: 11586.374 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG48
#45: Protein/peptide 50S ribosomal protein L22 /


Mass: 12253.359 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P61175
#46: Protein/peptide 50S ribosomal protein L23 /


Mass: 11222.160 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ0
#47: Protein/peptide 50S ribosomal protein L24 /


Mass: 11208.054 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60624
#48: Protein/peptide 50S ribosomal protein L25 /


Mass: 10713.465 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68919
#49: Protein/peptide 50S ribosomal protein L27 /


Mass: 9015.344 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L8
#50: Protein/peptide 50S ribosomal protein L28 /


Mass: 8896.354 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M2
#51: Protein/peptide 50S ribosomal protein L29 /


Mass: 7286.464 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M6
#52: Protein/peptide 50S ribosomal protein L30 /


Mass: 6423.625 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG51
#53: Protein/peptide 50S ribosomal protein L32 /


Mass: 6332.249 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N4
#54: Protein/peptide 50S ribosomal protein L33 /


Mass: 6257.436 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N9
#55: Protein/peptide 50S ribosomal protein L34 /


Mass: 5397.463 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7P5
#56: Protein/peptide 50S ribosomal protein L35 /


Mass: 7181.835 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q1
#57: Protein/peptide 50S ribosomal protein L36 /


Mass: 4377.390 Da / Num. of mol.: 1 / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q6

-
Protein/peptide / Non-polymers , 2 types, 2 molecules AY

#24: Protein/peptide viomycin /


Mass: 703.707 Da / Num. of mol.: 1
Feature: PRD_000226
classAntibiotic
nameViomycin
typeOligopeptide

Source: (synth.) Streptomyces (bacteria) / References: NOR: NOR00633
#58: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Formula: Zn / Zinc

-
Details

Sequence detailsTHE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS ...THE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS STUDY ARE MODELED AS TRNA-PHE AND AGGAGGUAAAAUUCUUCA, RESPECTIVELY, ACCORDING TO THE SEQUENCES IN THE CRYSTAL STRUCTURE USED AS A STARTING STRUCTURAL MODEL (PDB ENTRY 4GD1).

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / Reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeDetailsParent ID
1Pre-translocation ribosome bound to A/P, P/E hybrid state tRNARIBOSOMESample was monodisperse.0
270S ribosomeRIBOSOME1
3Transfer RNA1
4Messenger RNA1
Molecular weightValue: 3 MDa / Experimental value: NO
Buffer solutionName: Polymix buffer
Details: 10 mM HEPES-KOH, 5 mM MgCl2, 90 mM NH4Cl, 2 mM spermidine, 0.1 mM spermine, 6 mM BME, 0.5 mM viomycin, 0.5 mM GTP, 0.5 mM fusidic acid
pH: 7.6
SpecimenConc.: 0.4 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportDetails: C-flat 1.2/1.3 holey carbon 400 mesh copper grid, glow discharged with a current of -20 mA for 45 seconds in an EMITECH K100X glow discharge unit
VitrificationInstrument: FEI VITROBOT MARK II / Cryogen name: ETHANE / Humidity: 95 %
Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.
Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyMicroscope model: FEI TITAN KRIOS / Date: Nov 2, 2012
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELDBright-field microscopy / Nominal magnification: 133333 / Calibrated magnification: 134615 / Nominal defocus max: 6950 nm / Nominal defocus min: 1150 nm / Cs: 0.01 mm / Astigmatism: Automatically corrected using FEI software / Camera length: 0 mm
Specimen holderSpecimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 30 e/Å2 / Film or detector model: FEI FALCON I (4k x 4k)
Image scansNumber digital images: 13341
RadiationDiffraction protocol: SINGLE WAVELENGTH / Monochromatic or laue m l: M / Scattering type: x-ray
Radiation wavelengthRelative weight: 1

-
Processing

EM software
IDNameVersionCategory
1CTFFIND3CTF correction
2CNSmodel fitting
3UCSF Chimeramodel fitting
4EMAN23D reconstruction
5FREALIGN3D reconstruction
6IMAGIC3D reconstruction
7RSAMPLE3D reconstruction
CTF correctionDetails: CTFFIND3, FREALIGN per micrograph
SymmetryPoint symmetry: C1
3D reconstructionMethod: Projection Matching / Resolution: 7.6 Å / Resolution method: FSC 0.143 CUT-OFF / Number of particles: 85115 / Nominal pixel size: 1.05 / Actual pixel size: 1.04
Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification performed by Frealign) (Single particle--Applied symmetry: C1)
Symmetry type: POINT
Atomic model buildingDetails: REFINEMENT PROTOCOL--rigid body DETAILS--Chain Y not used in refinement
Ref protocol: RIGID BODY FIT / Ref space: REAL / Target criteria: Cross-correlation
Atomic model buildingPDB-ID: 4GD1
Number of atoms included #LASTProtein: 18591 / Nucleic acid: 36622 / Ligand: 0 / Solvent: 0 / Total: 55213

+
About Yorodumi

-
News

-
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary. This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated. See below links for details.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software). Now, EM Navigator and Yorodumi are based on the updated data.

External links: wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Jun 16, 2017. Omokage search with filter

Omokage search with filter

  • Result of Omokage search can be filtered by keywords and the database types

Related info.: Omokage search

+
Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi

+
Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi

+
Apr 13, 2016. Omokage search got faster

Omokage search got faster

  • The computation time became ~1/2 compared to the previous version by re-optimization of data accession
  • Enjoy "shape similarity" of biomolecules, more!

Related info.: Omokage search

Read more

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more