[English] 日本語
Yorodumi- EMDB-3202: Cryo-EM structure of the E. coli replicative DNA polymerase compl... -
+
Open data
-
Basic information
| Entry | Database: EMDB / ID: EMD-3202 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of the E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits) | |||||||||
Map data | E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits) | |||||||||
Sample |
| |||||||||
Keywords | DNA replication / DNA polymerase III alpha / DNA polymerase III beta / DNA polymerase III epsilon | |||||||||
| Function / homology | Function and homology informationDNA polymerase III, core complex / bacterial-type DNA replication / DNA polymerase III complex / DNA replication proofreading / lagging strand elongation / exonuclease activity / DNA strand elongation involved in DNA replication / leading strand elongation / error-prone translesion synthesis / regulation of DNA-templated DNA replication initiation ...DNA polymerase III, core complex / bacterial-type DNA replication / DNA polymerase III complex / DNA replication proofreading / lagging strand elongation / exonuclease activity / DNA strand elongation involved in DNA replication / leading strand elongation / error-prone translesion synthesis / regulation of DNA-templated DNA replication initiation / 3'-5' exonuclease activity / negative regulation of DNA-templated DNA replication initiation / DNA-templated DNA replication / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / DNA replication / DNA damage response / protein homodimerization activity / DNA binding / metal ion binding / identical protein binding / cytosol / cytoplasm Similarity search - Function | |||||||||
| Biological species | ![]() | |||||||||
| Method | single particle reconstruction / cryo EM / Resolution: 7.3 Å | |||||||||
Authors | Fernandez-Leiro R / Conrad J / Scheres HWS / Lamers MH | |||||||||
Citation | Journal: Elife / Year: 2015Title: cryo-EM structures of the replicative DNA polymerase reveal its dynamic interactions with the DNA sliding clamp, exonuclease and . Authors: Rafael Fernandez-Leiro / Julian Conrad / Sjors Hw Scheres / Meindert H Lamers / ![]() Abstract: The replicative DNA polymerase PolIIIα from is a uniquely fast and processive enzyme. For its activity it relies on the DNA sliding clamp β, the proofreading exonuclease ε and the C-terminal ...The replicative DNA polymerase PolIIIα from is a uniquely fast and processive enzyme. For its activity it relies on the DNA sliding clamp β, the proofreading exonuclease ε and the C-terminal domain of the clamp loader subunit τ. Due to the dynamic nature of the four-protein complex it has long been refractory to structural characterization. Here we present the 8 Å resolution cryo-electron microscopy structures of DNA-bound and DNA-free states of the PolIII-clamp-exonuclease-τ complex. The structures show how the polymerase is tethered to the DNA through multiple contacts with the clamp and exonuclease. A novel contact between the polymerase and clamp is made in the DNA bound state, facilitated by a large movement of the polymerase tail domain and τ. These structures provide crucial insights into the organization of the catalytic core of the replisome and form an important step towards determining the structure of the complete holoenzyme. | |||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | EM map: SurfView Molmil Jmol/JSmol |
| Supplemental images |
-
Downloads & links
-EMDB archive
| Map data | emd_3202.map.gz | 7.4 MB | EMDB map data format | |
|---|---|---|---|---|
| Header (meta data) | emd-3202-v30.xml emd-3202.xml | 16.4 KB 16.4 KB | Display Display | EMDB header |
| FSC (resolution estimation) | emd_3202_fsc.xml | 4.6 KB | Display | FSC data file |
| Images | EMD-3202.png emd_3202.png | 284.5 KB 284.5 KB | ||
| Masks | emd_3202_msk_1.map | 8 MB | Mask map | |
| Others | emd_3202_half_map_1.map.gz emd_3202_half_map_2.map.gz | 6 MB 6 MB | ||
| Archive directory | http://ftp.pdbj.org/pub/emdb/structures/EMD-3202 ftp://ftp.pdbj.org/pub/emdb/structures/EMD-3202 | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 5fkwMC ![]() 3198C ![]() 3201C ![]() 5fkuC ![]() 5fkvC M: atomic model generated by this map C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
| EMDB pages | EMDB (EBI/PDBe) / EMDataResource |
|---|---|
| Related items in Molecule of the Month |
-
Map
| File | Download / File: emd_3202.map.gz / Format: CCP4 / Size: 7.8 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Annotation | E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Projections & slices | Image control
Images are generated by Spider. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Voxel size | X=Y=Z: 1.76 Å | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Density |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Symmetry | Space group: 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Details | EMDB XML:
CCP4 map header:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Supplemental data
-Segmentation: mask for reconstructions
| Annotation | mask for reconstructions | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| File | emd_3202_msk_1.map | ||||||||||||
| Projections & Slices |
| ||||||||||||
| Density Histograms |
-Supplemental map: emd 3202 half map 1.map
| File | emd_3202_half_map_1.map | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Projections & Slices |
| ||||||||||||
| Density Histograms |
-Supplemental map: emd 3202 half map 2.map
| File | emd_3202_half_map_2.map | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Projections & Slices |
| ||||||||||||
| Density Histograms |
-
Sample components
-Entire : DNA polymerase III catalytic complex
| Entire | Name: DNA polymerase III catalytic complex |
|---|---|
| Components |
|
-Supramolecule #1000: DNA polymerase III catalytic complex
| Supramolecule | Name: DNA polymerase III catalytic complex / type: sample / ID: 1000 Details: Individual proteins purified individually and the complex was later assembled in vitro and purified over gel filtration DNA polymerase subunit tau is not visible in this map due to comformational heterogeneity Oligomeric state: 1 DNA polymerase III alpha : 2 DNA polymerase III beta: 1 DNA polymerase III epsilon : 1 dsDNA Number unique components: 5 |
|---|---|
| Molecular weight | Theoretical: 256 KDa |
-Macromolecule #1: DNA polymerase III alpha
| Macromolecule | Name: DNA polymerase III alpha / type: protein_or_peptide / ID: 1 / Name.synonym: dnaE Details: amino acid residues 920-924 of E. coli PolIII alpha were changed by site directed mutagenesis from QADMF to QLDLF Number of copies: 1 / Oligomeric state: 1 / Recombinant expression: Yes |
|---|---|
| Source (natural) | Organism: ![]() |
| Molecular weight | Theoretical: 132 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | UniProtKB: DNA polymerase III subunit alpha GO: DNA replication, DNA binding, DNA-directed DNA polymerase activity InterPro: DNA polymerase III, alpha subunit |
-Macromolecule #2: DNA polymerase III beta
| Macromolecule | Name: DNA polymerase III beta / type: protein_or_peptide / ID: 2 / Name.synonym: DNA clamp / Number of copies: 1 / Oligomeric state: 2 / Recombinant expression: Yes |
|---|---|
| Source (natural) | Organism: ![]() |
| Molecular weight | Theoretical: 81 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | UniProtKB: Beta sliding clamp / GO: DNA strand elongation involved in DNA replication / InterPro: DNA polymerase III, beta sliding clamp |
-Macromolecule #3: DNA polymerase III epsilon
| Macromolecule | Name: DNA polymerase III epsilon / type: protein_or_peptide / ID: 3 / Name.synonym: dnaQ Details: amino acid residues 182-187 of E. coli PolIII epsilon were changed by site directed mutagenesis from QTSMAF to QLSLPL Number of copies: 1 / Oligomeric state: 1 / Recombinant expression: Yes |
|---|---|
| Source (natural) | Organism: ![]() |
| Molecular weight | Theoretical: 27.3762 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | UniProtKB: DNA polymerase III subunit epsilon / GO: exonuclease activity / InterPro: DNA polymerase 3, epsilon subunit |
-Macromolecule #4: primer-template duplex DNA
| Macromolecule | Name: primer-template duplex DNA / type: dna / ID: 4 / Name.synonym: dsDNA Details: template strans has a 4 nucleotide overhang, sequence as follows: TCAGGAGTCCTTCGTCCTAGTACTACTCC Classification: DNA / Structure: DOUBLE HELIX / Synthetic?: Yes |
|---|---|
| Source (natural) | Organism: unidentified (others) |
| Molecular weight | Theoretical: 15.5 KDa |
| Sequence | String: GGAGTAGTAC TAGGACGAAG GACTC |
-Experimental details
-Structure determination
| Method | cryo EM |
|---|---|
Processing | single particle reconstruction |
| Aggregation state | particle |
-
Sample preparation
| Concentration | 1 mg/mL |
|---|---|
| Buffer | pH: 7.5 Details: 25 mM Hepes pH 7.5, 50 mM Potassium Glutamate, 3 mM Magnesium Acetate, 2 mM DTT |
| Grid | Details: glow-discharged holey carbon cryo-EM grids (Quantifoil Cu R1.2/1.3 400 mesh) |
| Vitrification | Cryogen name: ETHANE / Chamber humidity: 100 % / Chamber temperature: 110 K / Instrument: FEI VITROBOT MARK III Method: Prior to sample preparation 0.1 volumes of 0.05% Tween 20 were added to the sample 3 microliters were pipetted onto the grid and blotted for 4 seconds |
-
Electron microscopy
| Microscope | FEI TITAN KRIOS |
|---|---|
| Temperature | Min: 80 K / Max: 90 K / Average: 85 K |
| Alignment procedure | Legacy - Astigmatism: Objective lens astigmatism was corrected at 64,000 times magnification |
| Date | May 12, 2014 |
| Image recording | Category: CCD / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Digitization - Sampling interval: 5 µm / Number real images: 1350 / Average electron dose: 40 e/Å2 / Details: 20 frames/micrograph / Bits/pixel: 32 |
| Electron beam | Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN |
| Electron optics | Calibrated magnification: 28409 / Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 2.7 mm / Nominal defocus max: 4.0 µm / Nominal defocus min: 2.0 µm / Nominal magnification: 64000 |
| Sample stage | Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
Movie
Controller
About Yorodumi


Keywords
Authors
Citation
UCSF Chimera
















Z (Sec.)
Y (Row.)
X (Col.)













































Processing

