[English] 日本語
Yorodumi- PDB-9qn8: RAD51 filament in complex with calcium and ATP bound by the RAD51... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9qn8 | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus | |||||||||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN / RAD51 recombinase / RAD51AP1 / filament modulation / homologous recombination / nucleotide hydrolysis | |||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationD-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to cisplatin / DNA recombinase assembly / telomere maintenance via telomere lengthening ...D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to cisplatin / DNA recombinase assembly / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / cellular response to camptothecin / DNA strand invasion / mitotic recombination / lateral element / DNA strand exchange activity / Impaired BRCA2 binding to PALB2 / telomere maintenance via recombination / regulation of DNA damage checkpoint / reciprocal meiotic recombination / single-stranded DNA helicase activity / regulation of double-strand break repair via homologous recombination / ATP-dependent DNA damage sensor activity / HDR through Single Strand Annealing (SSA) / nuclear chromosome / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / Transcriptional Regulation by E2F6 / Impaired BRCA2 binding to RAD51 / replication fork processing / response to X-ray / Presynaptic phase of homologous DNA pairing and strand exchange / ATP-dependent activity, acting on DNA / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / cellular response to ionizing radiation / condensed nuclear chromosome / cellular response to gamma radiation / meiotic cell cycle / protein-DNA complex / PML body / double-strand break repair via homologous recombination / Meiotic recombination / response to toxic substance / Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement / HDR through Homologous Recombination (HRR) / chromosome / single-stranded DNA binding / site of double-strand break / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / response to xenobiotic stimulus / mitochondrial matrix / hydrolase activity / DNA repair / centrosome / chromatin binding / DNA damage response / nucleolus / chromatin / perinuclear region of cytoplasm / enzyme binding / protein-containing complex / mitochondrion / DNA binding / RNA binding / nucleoplasm / ATP binding / identical protein binding / nucleus / cytosol / cytoplasm Similarity search - Function | |||||||||||||||||||||||||||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.14 Å | |||||||||||||||||||||||||||||||||
Authors | Kuhlen, L. / Zhang, X. | |||||||||||||||||||||||||||||||||
| Funding support | United Kingdom, 1items
| |||||||||||||||||||||||||||||||||
Citation | Journal: Proc Natl Acad Sci U S A / Year: 2025Title: RAD51AP1 is a versatile RAD51 modulator. Authors: Lucas Kuhlen / Bilge Argunhan / Pengtao Liang / Janet Zhong / Laura Masino / Xiaodong Zhang / ![]() Abstract: RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of ...RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of RAD51AP1 diminishes HR and overexpression is common in cancer, where it is associated with malignancy. Here, we show that RAD51AP1 has a hitherto unknown role in modulating the RAD51 recombinase, the central player in HR. Through a combination of biochemistry and structural biology, we reveal that RAD51AP1 possesses at least three RAD51-binding sites that facilitate its binding across two adjacent RAD51 molecules. We uncover a previously unidentified RAD51-binding mode that stabilizes the RAD51 N-terminal domain and protomer interface in the filaments. We uncover a previously undescribed role for RAD51AP1 in stabilizing RAD51-ssDNA filaments and promoting strand exchange. Our structural data provide the molecular basis for how RAD51AP1 binding induces conformational changes that promote RAD51 DNA association and oligomerization, therefore promoting filament nucleation, stabilization, and strand exchange. Further, we resolved structures of RAD51-ssDNA filaments in the presence of Mg-ATP and upon hydrolysis to Mg-ADP, revealing that RAD51 filaments expand upon ATP hydrolysis and explaining how ADP reduces RAD51-DNA binding. Our findings reveal RAD51AP1 as a versatile RAD51 modulator and RAD51 filament remodeler and shed previously unidentified insights into the modulation of HR, which is critical for the maintenance of genome stability. | |||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9qn8.cif.gz | 426.3 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9qn8.ent.gz | 332.1 KB | Display | PDB format |
| PDBx/mmJSON format | 9qn8.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/qn/9qn8 ftp://data.pdbj.org/pub/pdb/validation_reports/qn/9qn8 | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 53239MC ![]() 9qnaC ![]() 9qnbC ![]() 9qncC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein , 2 types, 12 molecules ACEGIKBDFHJL
| #1: Protein | Mass: 37009.125 Da / Num. of mol.: 6 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51, RAD51A, RECA / Production host: ![]() #2: Protein | Mass: 39891.938 Da / Num. of mol.: 6 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51AP1, PIR51 / Production host: ![]() |
|---|
-DNA chain , 1 types, 1 molecules Z
| #3: DNA chain | Mass: 6343.091 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: mixed oligomer GCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGC modelled as poly dT Source: (synth.) synthetic construct (others) |
|---|
-Non-polymers , 3 types, 21 molecules 




| #4: Chemical | ChemComp-ATP / #5: Chemical | ChemComp-CA / #6: Chemical | ChemComp-K / |
|---|
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | N |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: FILAMENT / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus Type: COMPLEX / Entity ID: #1-#3 / Source: RECOMBINANT |
|---|---|
| Molecular weight | Experimental value: NO |
| Source (natural) | Organism: Homo sapiens (human) |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: TFS KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 900 nm |
| Image recording | Electron dose: 42 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3D reconstruction | Resolution: 3.14 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 137283 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refinement | Highest resolution: 3.14 Å Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS) | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 1items
Citation






PDBj













































FIELD EMISSION GUN