[English] 日本語
Yorodumi
- PDB-9qn8: RAD51 filament in complex with calcium and ATP bound by the RAD51... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9qn8
TitleRAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus
Components
  • DNA
  • DNA repair protein RAD51 homolog 1
  • RAD51-associated protein 1
KeywordsDNA BINDING PROTEIN / RAD51 recombinase / RAD51AP1 / filament modulation / homologous recombination / nucleotide hydrolysis
Function / homology
Function and homology information


D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening ...D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / nuclear ubiquitin ligase complex / cellular response to cisplatin / DNA strand invasion / cellular response to hydroxyurea / mitotic recombination / replication-born double-strand break repair via sister chromatid exchange / lateral element / regulation of DNA damage checkpoint / DNA strand exchange activity / Impaired BRCA2 binding to PALB2 / telomere maintenance via recombination / single-stranded DNA helicase activity / reciprocal meiotic recombination / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / HDR through Single Strand Annealing (SSA) / ATP-dependent DNA damage sensor activity / regulation of double-strand break repair via homologous recombination / nuclear chromosome / Impaired BRCA2 binding to RAD51 / Transcriptional Regulation by E2F6 / replication fork processing / Presynaptic phase of homologous DNA pairing and strand exchange / response to X-ray / ATP-dependent activity, acting on DNA / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / condensed nuclear chromosome / cellular response to ionizing radiation / male germ cell nucleus / meiotic cell cycle / cellular response to gamma radiation / double-strand break repair via homologous recombination / PML body / HDR through Homologous Recombination (HRR) / Meiotic recombination / response to toxic substance / single-stranded DNA binding / site of double-strand break / chromosome / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / response to xenobiotic stimulus / DNA repair / DNA damage response / chromatin binding / centrosome / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / ATP hydrolysis activity / protein-containing complex / mitochondrion / DNA binding / RNA binding / nucleoplasm / ATP binding / identical protein binding / nucleus / cytoplasm / cytosol
Similarity search - Function
RAD51 interacting motif / : / RAD51 interacting motif / DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain ...RAD51 interacting motif / : / RAD51 interacting motif / DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / Helix-hairpin-helix domain / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE-5'-TRIPHOSPHATE / : / DNA / DNA (> 10) / DNA repair protein RAD51 homolog 1 / RAD51-associated protein 1
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.14 Å
AuthorsKuhlen, L. / Zhang, X.
Funding support United Kingdom, 1items
OrganizationGrant numberCountry
Wellcome Trust United Kingdom
CitationJournal: Proc Natl Acad Sci U S A / Year: 2025
Title: RAD51AP1 is a versatile RAD51 modulator.
Authors: Lucas Kuhlen / Bilge Argunhan / Pengtao Liang / Janet Zhong / Laura Masino / Xiaodong Zhang /
Abstract: RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of ...RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of RAD51AP1 diminishes HR and overexpression is common in cancer, where it is associated with malignancy. Here, we show that RAD51AP1 has a hitherto unknown role in modulating the RAD51 recombinase, the central player in HR. Through a combination of biochemistry and structural biology, we reveal that RAD51AP1 possesses at least three RAD51-binding sites that facilitate its binding across two adjacent RAD51 molecules. We uncover a previously unidentified RAD51-binding mode that stabilizes the RAD51 N-terminal domain and protomer interface in the filaments. We uncover a previously undescribed role for RAD51AP1 in stabilizing RAD51-ssDNA filaments and promoting strand exchange. Our structural data provide the molecular basis for how RAD51AP1 binding induces conformational changes that promote RAD51 DNA association and oligomerization, therefore promoting filament nucleation, stabilization, and strand exchange. Further, we resolved structures of RAD51-ssDNA filaments in the presence of Mg-ATP and upon hydrolysis to Mg-ADP, revealing that RAD51 filaments expand upon ATP hydrolysis and explaining how ADP reduces RAD51-DNA binding. Our findings reveal RAD51AP1 as a versatile RAD51 modulator and RAD51 filament remodeler and shed previously unidentified insights into the modulation of HR, which is critical for the maintenance of genome stability.
History
DepositionMar 24, 2025Deposition site: PDBE / Processing site: PDBE
Revision 1.0Dec 3, 2025Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Additional map / Part number: 2 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Mask / Part number: 1 / Data content type: Mask / Provider: repository / Type: Initial release
Revision 1.0Dec 3, 2025Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Dec 17, 2025Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 1.1Dec 17, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / EM metadata / Category: citation / citation_author / em_admin
Data content type: EM metadata / EM metadata ...EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA repair protein RAD51 homolog 1
B: RAD51-associated protein 1
C: DNA repair protein RAD51 homolog 1
D: RAD51-associated protein 1
E: DNA repair protein RAD51 homolog 1
F: RAD51-associated protein 1
G: DNA repair protein RAD51 homolog 1
H: RAD51-associated protein 1
I: DNA repair protein RAD51 homolog 1
J: RAD51-associated protein 1
K: DNA repair protein RAD51 homolog 1
L: RAD51-associated protein 1
Z: DNA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)471,85434
Polymers467,74913
Non-polymers4,10421
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
Protein , 2 types, 12 molecules ACEGIKBDFHJL

#1: Protein
DNA repair protein RAD51 homolog 1 / HsRAD51 / hRAD51 / RAD51 homolog A


Mass: 37009.125 Da / Num. of mol.: 6
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51, RAD51A, RECA / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: Q06609
#2: Protein
RAD51-associated protein 1 / HsRAD51AP1 / RAD51-interacting protein


Mass: 39891.938 Da / Num. of mol.: 6
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51AP1, PIR51 / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: Q96B01

-
DNA chain , 1 types, 1 molecules Z

#3: DNA chain DNA


Mass: 6343.091 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: mixed oligomer GCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGC modelled as poly dT
Source: (synth.) synthetic construct (others)

-
Non-polymers , 3 types, 21 molecules

#4: Chemical
ChemComp-ATP / ADENOSINE-5'-TRIPHOSPHATE


Mass: 507.181 Da / Num. of mol.: 7 / Source method: obtained synthetically / Formula: C10H16N5O13P3 / Feature type: SUBJECT OF INVESTIGATION / Comment: ATP, energy-carrying molecule*YM
#5: Chemical
ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 7 / Source method: obtained synthetically / Formula: Ca / Feature type: SUBJECT OF INVESTIGATION
#6: Chemical
ChemComp-K / POTASSIUM ION


Mass: 39.098 Da / Num. of mol.: 7 / Source method: obtained synthetically / Formula: K / Feature type: SUBJECT OF INVESTIGATION

-
Details

Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: FILAMENT / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus
Type: COMPLEX / Entity ID: #1-#3 / Source: RECOMBINANT
Molecular weightExperimental value: NO
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Escherichia coli BL21(DE3) (bacteria)
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 900 nm
Image recordingElectron dose: 42 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 3.14 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 137283 / Symmetry type: POINT
RefinementHighest resolution: 3.14 Å
Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS)
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00216210
ELECTRON MICROSCOPYf_angle_d0.46622003
ELECTRON MICROSCOPYf_dihedral_angle_d18.2246259
ELECTRON MICROSCOPYf_chiral_restr0.0372506
ELECTRON MICROSCOPYf_plane_restr0.0032764

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more