[English] 日本語
Yorodumi- PDB-9qn8: RAD51 filament in complex with calcium and ATP bound by the RAD51... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9qn8 | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus | |||||||||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN / RAD51 recombinase / RAD51AP1 / filament modulation / homologous recombination / nucleotide hydrolysis | |||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationD-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening ...D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / nuclear ubiquitin ligase complex / cellular response to cisplatin / DNA strand invasion / cellular response to hydroxyurea / mitotic recombination / DNA strand exchange activity / replication-born double-strand break repair via sister chromatid exchange / lateral element / Impaired BRCA2 binding to PALB2 / regulation of DNA damage checkpoint / telomere maintenance via recombination / single-stranded DNA helicase activity / reciprocal meiotic recombination / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / HDR through Single Strand Annealing (SSA) / ATP-dependent DNA damage sensor activity / regulation of double-strand break repair via homologous recombination / nuclear chromosome / Impaired BRCA2 binding to RAD51 / Transcriptional Regulation by E2F6 / replication fork processing / Presynaptic phase of homologous DNA pairing and strand exchange / response to X-ray / ATP-dependent activity, acting on DNA / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / condensed nuclear chromosome / cellular response to ionizing radiation / meiotic cell cycle / male germ cell nucleus / cellular response to gamma radiation / double-strand break repair via homologous recombination / PML body / HDR through Homologous Recombination (HRR) / Meiotic recombination / response to toxic substance / single-stranded DNA binding / chromosome / site of double-strand break / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / response to xenobiotic stimulus / DNA repair / DNA damage response / centrosome / chromatin binding / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / ATP hydrolysis activity / protein-containing complex / mitochondrion / DNA binding / RNA binding / nucleoplasm / ATP binding / identical protein binding / nucleus / cytosol / cytoplasm Similarity search - Function | |||||||||||||||||||||||||||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.14 Å | |||||||||||||||||||||||||||||||||
Authors | Kuhlen, L. / Zhang, X. | |||||||||||||||||||||||||||||||||
| Funding support | United Kingdom, 1items
| |||||||||||||||||||||||||||||||||
Citation | Journal: To Be PublishedTitle: RAD51AP1 is a versatile RAD51 modulator Authors: Kuhlen, L. / Zhang, X. | |||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9qn8.cif.gz | 425.7 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9qn8.ent.gz | 332 KB | Display | PDB format |
| PDBx/mmJSON format | 9qn8.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Summary document | 9qn8_validation.pdf.gz | 1.9 MB | Display | wwPDB validaton report |
|---|---|---|---|---|
| Full document | 9qn8_full_validation.pdf.gz | 1.9 MB | Display | |
| Data in XML | 9qn8_validation.xml.gz | 65.3 KB | Display | |
| Data in CIF | 9qn8_validation.cif.gz | 97.2 KB | Display | |
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/qn/9qn8 ftp://data.pdbj.org/pub/pdb/validation_reports/qn/9qn8 | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 53239MC ![]() 9qnaC ![]() 9qnbC ![]() 9qncC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein , 2 types, 12 molecules ACEGIKBDFHJL
| #1: Protein | Mass: 37009.125 Da / Num. of mol.: 6 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51, RAD51A, RECA / Production host: ![]() #2: Protein | Mass: 39891.938 Da / Num. of mol.: 6 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51AP1, PIR51 / Production host: ![]() |
|---|
-DNA chain , 1 types, 1 molecules Z
| #3: DNA chain | Mass: 6343.091 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: mixed oligomer GCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGC modelled as poly dT Source: (synth.) synthetic construct (others) |
|---|
-Non-polymers , 3 types, 21 molecules 




| #4: Chemical | ChemComp-ATP / #5: Chemical | ChemComp-CA / #6: Chemical | ChemComp-K / |
|---|
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | N |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: FILAMENT / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus Type: COMPLEX / Entity ID: #1-#3 / Source: RECOMBINANT |
|---|---|
| Molecular weight | Experimental value: NO |
| Source (natural) | Organism: Homo sapiens (human) |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: TFS KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 3000 nm / Nominal defocus min: 900 nm |
| Image recording | Electron dose: 42 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3D reconstruction | Resolution: 3.14 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 137283 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refinement | Highest resolution: 3.14 Å Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS) | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 1items
Citation






PDBj













































FIELD EMISSION GUN