- EMDB-53239: RAD51 filament in complex with calcium and ATP bound by the RAD51... -
+
Open data
ID or keywords:
Loading...
-
Basic information
Entry
Database: EMDB / ID: EMD-53239
Title
RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus
Map data
Sample
Complex: RAD51 filament in complex with calcium and ATP bound by the RAD51AP1 C-terminus
Protein or peptide: DNA repair protein RAD51 homolog 1
Protein or peptide: RAD51-associated protein 1
DNA: DNA
Ligand: ADENOSINE-5'-TRIPHOSPHATE
Ligand: CALCIUM ION
Ligand: POTASSIUM ION
Keywords
RAD51 recombinase / RAD51AP1 / filament modulation / homologous recombination / nucleotide hydrolysis / DNA BINDING PROTEIN
Function / homology
Function and homology information
D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening ...D-loop DNA binding / positive regulation of reciprocal meiotic recombination / DNA secondary structure binding / presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / cellular response to camptothecin / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / nuclear ubiquitin ligase complex / cellular response to cisplatin / DNA strand invasion / cellular response to hydroxyurea / mitotic recombination / replication-born double-strand break repair via sister chromatid exchange / lateral element / regulation of DNA damage checkpoint / DNA strand exchange activity / Impaired BRCA2 binding to PALB2 / telomere maintenance via recombination / single-stranded DNA helicase activity / reciprocal meiotic recombination / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / HDR through Single Strand Annealing (SSA) / ATP-dependent DNA damage sensor activity / regulation of double-strand break repair via homologous recombination / nuclear chromosome / Impaired BRCA2 binding to RAD51 / Transcriptional Regulation by E2F6 / replication fork processing / Presynaptic phase of homologous DNA pairing and strand exchange / response to X-ray / ATP-dependent activity, acting on DNA / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / condensed chromosome / DNA polymerase binding / condensed nuclear chromosome / cellular response to ionizing radiation / male germ cell nucleus / meiotic cell cycle / cellular response to gamma radiation / double-strand break repair via homologous recombination / PML body / HDR through Homologous Recombination (HRR) / Meiotic recombination / response to toxic substance / single-stranded DNA binding / site of double-strand break / chromosome / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / response to xenobiotic stimulus / DNA repair / DNA damage response / chromatin binding / centrosome / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / ATP hydrolysis activity / protein-containing complex / mitochondrion / DNA binding / RNA binding / nucleoplasm / ATP binding / identical protein binding / nucleus / cytoplasm / cytosol Similarity search - Function
RAD51 interacting motif / : / RAD51 interacting motif / DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain ...RAD51 interacting motif / : / RAD51 interacting motif / DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / Helix-hairpin-helix domain / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / P-loop containing nucleoside triphosphate hydrolase Similarity search - Domain/homology
Journal: Proc Natl Acad Sci U S A / Year: 2025 Title: RAD51AP1 is a versatile RAD51 modulator. Authors: Lucas Kuhlen / Bilge Argunhan / Pengtao Liang / Janet Zhong / Laura Masino / Xiaodong Zhang / Abstract: RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of ...RAD51AP1 is an emergent key factor in homologous recombination (HR), the major pathway for accurate repair of DNA double-strand breaks, and in alternative lengthening of telomeres (ALT). Depletion of RAD51AP1 diminishes HR and overexpression is common in cancer, where it is associated with malignancy. Here, we show that RAD51AP1 has a hitherto unknown role in modulating the RAD51 recombinase, the central player in HR. Through a combination of biochemistry and structural biology, we reveal that RAD51AP1 possesses at least three RAD51-binding sites that facilitate its binding across two adjacent RAD51 molecules. We uncover a previously unidentified RAD51-binding mode that stabilizes the RAD51 N-terminal domain and protomer interface in the filaments. We uncover a previously undescribed role for RAD51AP1 in stabilizing RAD51-ssDNA filaments and promoting strand exchange. Our structural data provide the molecular basis for how RAD51AP1 binding induces conformational changes that promote RAD51 DNA association and oligomerization, therefore promoting filament nucleation, stabilization, and strand exchange. Further, we resolved structures of RAD51-ssDNA filaments in the presence of Mg-ATP and upon hydrolysis to Mg-ADP, revealing that RAD51 filaments expand upon ATP hydrolysis and explaining how ADP reduces RAD51-DNA binding. Our findings reveal RAD51AP1 as a versatile RAD51 modulator and RAD51 filament remodeler and shed previously unidentified insights into the modulation of HR, which is critical for the maintenance of genome stability.
Name: DNA / type: dna / ID: 3 Details: mixed oligomer GCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGC modelled as poly dT Number of copies: 1 / Classification: DNA
In the structure databanks used in Yorodumi, some data are registered as the other names, "COVID-19 virus" and "2019-nCoV". Here are the details of the virus and the list of structure data.
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)
EMDB accession codes are about to change! (news from PDBe EMDB page)
The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
The EM Navigator/Yorodumi systems omit the EMD- prefix.
Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator
Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.
Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi