[English] 日本語
Yorodumi
- PDB-7c9c: Human DMC1 pre-synaptic complexes -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7c9c
TitleHuman DMC1 pre-synaptic complexes
Components
  • DNA (5'-D(P*TP*TP*TP*TP*TP*TP*TP*TP*T)-3')
  • Meiotic recombination protein DMC1/LIM15 homolog
KeywordsRECOMBINATION/DNA / meiotic homologous recombination / DNA repair / ATPase / Recombination / RECOMBINATION-DNA complex
Function / homology
Function and homology information


female gamete generation / chromosome organization involved in meiotic cell cycle / DNA recombinase assembly / double-strand break repair involved in meiotic recombination / DNA strand invasion / mitotic recombination / lateral element / DNA strand exchange activity / reciprocal meiotic recombination / ATP-dependent DNA damage sensor activity ...female gamete generation / chromosome organization involved in meiotic cell cycle / DNA recombinase assembly / double-strand break repair involved in meiotic recombination / DNA strand invasion / mitotic recombination / lateral element / DNA strand exchange activity / reciprocal meiotic recombination / ATP-dependent DNA damage sensor activity / ATP-dependent activity, acting on DNA / condensed nuclear chromosome / meiotic cell cycle / Meiotic recombination / Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement / site of double-strand break / chromosome / single-stranded DNA binding / double-stranded DNA binding / spermatogenesis / chromosome, telomeric region / DNA binding / nucleoplasm / ATP binding / identical protein binding / nucleus
Similarity search - Function
Meiotic recombination protein Dmc1 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / : ...Meiotic recombination protein Dmc1 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / : / SAM-like Helix-hairpin-helix tandem / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER / DNA / Meiotic recombination protein DMC1 homolog
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / helical reconstruction / cryo EM / Resolution: 3.33 Å
AuthorsLuo, S.C. / Yeh, H.Y. / Chi, P. / Ho, M.C. / Tsai, M.D.
Funding support Taiwan, 3items
OrganizationGrant numberCountry
Academia Sinica (Taiwan)AS-KPQ-109-TPP2 Taiwan
Academia Sinica (Taiwan)AS-CFII-108-110 Taiwan
Academia Sinica (Taiwan)AS-KPQ-105-TPP Taiwan
CitationJournal: Nat Commun / Year: 2021
Title: Identification of fidelity-governing factors in human recombinases DMC1 and RAD51 from cryo-EM structures.
Authors: Shih-Chi Luo / Hsin-Yi Yeh / Wei-Hsuan Lan / Yi-Min Wu / Cheng-Han Yang / Hao-Yen Chang / Guan-Chin Su / Chia-Yi Lee / Wen-Jin Wu / Hung-Wen Li / Meng-Chiao Ho / Peter Chi / Ming-Daw Tsai /
Abstract: Both high-fidelity and mismatch-tolerant recombination, catalyzed by RAD51 and DMC1 recombinases, respectively, are indispensable for genomic integrity. Here, we use cryo-EM, MD simulation and ...Both high-fidelity and mismatch-tolerant recombination, catalyzed by RAD51 and DMC1 recombinases, respectively, are indispensable for genomic integrity. Here, we use cryo-EM, MD simulation and functional analysis to elucidate the structural basis for the mismatch tolerance of DMC1. Structural analysis of DMC1 presynaptic and postsynaptic complexes suggested that the lineage-specific Loop 1 Gln244 (Met243 in RAD51) may help stabilize DNA backbone, whereas Loop 2 Pro274 and Gly275 (Val273/Asp274 in RAD51) may provide an open "triplet gate" for mismatch tolerance. In support, DMC1-Q244M displayed marked increase in DNA dynamics, leading to unobservable DNA map. MD simulation showed highly dispersive mismatched DNA ensemble in RAD51 but well-converged DNA in DMC1 and RAD51-V273P/D274G. Replacing Loop 1 or Loop 2 residues in DMC1 with RAD51 counterparts enhanced DMC1 fidelity, while reciprocal mutations in RAD51 attenuated its fidelity. Our results show that three Loop 1/Loop 2 residues jointly enact contrasting fidelities of DNA recombinases.
History
DepositionJun 5, 2020Deposition site: PDBJ / Processing site: PDBJ
Revision 1.0Nov 25, 2020Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Nov 25, 2020Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Jan 27, 2021Group: Database references / Category: citation / citation_author
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year
Revision 1.2Apr 9, 2025Group: Data collection / Database references / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / em_admin / pdbx_entry_details
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _em_admin.last_update / _pdbx_entry_details.has_protein_modification
Revision 1.1Apr 9, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / Category: database_2 / em_admin / Data content type: EM metadata / EM metadata / EM metadata
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession / _em_admin.last_update
Revision 1.3Sep 17, 2025Group: Advisory / Data collection / Derived calculations
Category: em_admin / pdbx_validate_close_contact ...em_admin / pdbx_validate_close_contact / struct_conn / struct_conn_type
Item: _em_admin.last_update
Revision 1.2Sep 17, 2025Data content type: EM metadata / Data content type: EM metadata / Group: Experimental summary / Data content type: EM metadata / Category: em_admin / Data content type: EM metadata / Item: _em_admin.last_update

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Simplified surface model + fitted atomic model
  • EMDB-30311
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-30311
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
D: DNA (5'-D(P*TP*TP*TP*TP*TP*TP*TP*TP*T)-3')
A: Meiotic recombination protein DMC1/LIM15 homolog
B: Meiotic recombination protein DMC1/LIM15 homolog
C: Meiotic recombination protein DMC1/LIM15 homolog
hetero molecules


Theoretical massNumber of molelcules
Total (without water)117,52510
Polymers115,8864
Non-polymers1,6396
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: scanning transmission electron microscopy
TypeNameSymmetry operationNumber
identity operation1_5551
Buried area13850 Å2
ΔGint-96 kcal/mol
Surface area39570 Å2

-
Components

#1: DNA chain DNA (5'-D(P*TP*TP*TP*TP*TP*TP*TP*TP*T)-3')


Mass: 2692.778 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#2: Protein Meiotic recombination protein DMC1/LIM15 homolog


Mass: 37731.031 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: DMC1, DMC1H, LIM15 / Production host: Escherichia coli (E. coli) / Strain (production host): BLR / References: UniProt: Q14565
#3: Chemical ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 3 / Source method: obtained synthetically / Formula: Ca
#4: Chemical ChemComp-ANP / PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER


Mass: 506.196 Da / Num. of mol.: 3 / Source method: obtained synthetically / Formula: C10H17N6O12P3 / Comment: AMP-PNP, energy-carrying molecule analogue*YM
Has ligand of interestN
Has protein modificationN
Sequence detailsAuthors know the sequence of chains D: ...Authors know the sequence of chains D: TTATGTTCATTTTTTATATCCTTTACTTTATTTTCTCTGTTTATTCATTTACTTATTTTGTATTATCCTTATCTTATTTA. Since the DNA sequence could not be revealed by the helical reconstruction method, authors have used poly-T for model building.

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: FILAMENT / 3D reconstruction method: helical reconstruction

-
Sample preparation

ComponentName: DMC1-ssDNA filament / Type: COMPLEX / Entity ID: #1-#2 / Source: RECOMBINANT
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 7.5
Details: 25 mM Tris-HCl, pH 7.5, 50 mM KCl and 1 mM dithiothreitol) containing 2 mM AMP-PNP and 5 mM CaCl2
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Details: protein sample were applied onto a pre-glow-discharged graphene-oxide coated Quantifoil holey carbon grid (1.2/1.3, 200 mesh) using published protocol
Specimen supportGrid material: GRAPHENE OXIDE / Grid mesh size: 200 divisions/in. / Grid type: Quantifoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 295 K
Details: The grids were blotted for 1 sec at 22 degree C with 100% relative humidity and plunge-frozen in liquid ethane cooled by liquid nitrogen using a Vitrobot Mark IV (Thermo Fisher).

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 165000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 1500 nm / Cs: 2.7 mm / C2 aperture diameter: 70 µm / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER / Residual tilt: 10 mradians
Image recordingAverage exposure time: 5 sec. / Electron dose: 50 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Num. of grids imaged: 1
EM imaging opticsEnergyfilter name: GIF Quantum LS / Energyfilter slit width: 30 eV
Image scansSampling size: 5 µm / Width: 3838 / Height: 3710 / Movie frames/image: 50 / Used frames/image: 1-50

-
Processing

EM software
IDNameVersionCategory
2EPU2.2.0image acquisition
4SPHIRE3CTF correction
7PHENIX1.14model fitting
9Coot0.8.9.2model refinement
10PHENIX1.14model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Helical symmertyAngular rotation/subunit: 55.48 ° / Axial rise/subunit: 15.71 Å / Axial symmetry: C1
Particle selectionNum. of particles selected: 192466
3D reconstructionResolution: 3.33 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 71790 / Symmetry type: HELICAL

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more