[English] 日本語
Yorodumi- PDB-6tnf: Structure of monoubiquitinated FANCD2 in complex with FANCI and DNA -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 6tnf | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Structure of monoubiquitinated FANCD2 in complex with FANCI and DNA | |||||||||
Components |
| |||||||||
Keywords | DNA BINDING PROTEIN / Fanconi anaemia / ubiquitin / DNA repair / DNA damage / inter-strand crosslink | |||||||||
| Function / homology | Function and homology informationFanconi Anemia Pathway in DNA repair / Fanconi Anemia Pathway / Fanconi anaemia nuclear complex / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / mitotic intra-S DNA damage checkpoint signaling / interstrand cross-link repair / condensed chromosome / DNA polymerase binding / Maturation of protein E ...Fanconi Anemia Pathway in DNA repair / Fanconi Anemia Pathway / Fanconi anaemia nuclear complex / homologous chromosome pairing at meiosis / double-strand break repair involved in meiotic recombination / mitotic intra-S DNA damage checkpoint signaling / interstrand cross-link repair / condensed chromosome / DNA polymerase binding / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / IRAK2 mediated activation of TAK1 complex / Prevention of phagosomal-lysosomal fusion / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Negative regulation of FLT3 / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Constitutive Signaling by NOTCH1 HD Domain Mutants / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Regulation of FZD by ubiquitination / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / TRAF6-mediated induction of TAK1 complex within TLR4 complex / NF-kB is activated and signals survival / Regulation of pyruvate metabolism / Pexophagy / Regulation of innate immune responses to cytosolic DNA / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Regulation of PTEN localization / VLDLR internalisation and degradation / Activated NOTCH1 Transmits Signal to the Nucleus / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / positive regulation of protein ubiquitination / Translesion synthesis by REV1 / Regulation of BACH1 activity / TICAM1, RIP1-mediated IKK complex recruitment / Translesion synthesis by POLK / InlB-mediated entry of Listeria monocytogenes into host cell / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Downregulation of TGF-beta receptor signaling / Josephin domain DUBs / Translesion synthesis by POLI / IKK complex recruitment mediated by RIP1 / Gap-filling DNA repair synthesis and ligation in GG-NER / PINK1-PRKN Mediated Mitophagy / Regulation of activated PAK-2p34 by proteasome mediated degradation / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / TNFR1-induced NF-kappa-B signaling pathway / TCF dependent signaling in response to WNT / Autodegradation of Cdh1 by Cdh1:APC/C / Regulation of NF-kappa B signaling / APC/C:Cdc20 mediated degradation of Securin / activated TAK1 mediates p38 MAPK activation / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Asymmetric localization of PCP proteins / Ubiquitin-dependent degradation of Cyclin D / Regulation of signaling by CBL / SCF-beta-TrCP mediated degradation of Emi1 / NIK-->noncanonical NF-kB signaling / TNFR2 non-canonical NF-kB pathway / AUF1 (hnRNP D0) binds and destabilizes mRNA / NOTCH3 Activation and Transmission of Signal to the Nucleus / Negative regulators of DDX58/IFIH1 signaling / Fanconi Anemia Pathway / Peroxisomal protein import / Negative regulation of FGFR3 signaling / Deactivation of the beta-catenin transactivating complex / Assembly of the pre-replicative complex / Vpu mediated degradation of CD4 / Stabilization of p53 / Negative regulation of FGFR2 signaling / Cdc20:Phospho-APC/C mediated degradation of Cyclin A / Negative regulation of FGFR4 signaling / Degradation of DVL / Dectin-1 mediated noncanonical NF-kB signaling / Downregulation of SMAD2/3:SMAD4 transcriptional activity / Negative regulation of FGFR1 signaling / Degradation of CRY and PER proteins / Degradation of AXIN / EGFR downregulation / Regulation of TNFR1 signaling Similarity search - Function | |||||||||
| Biological species | ![]() Homo sapiens (human)synthetic construct (others) | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.8 Å | |||||||||
Authors | Alcon, P. / Shakeel, S. / Passmore, L.A. | |||||||||
| Funding support | United Kingdom, 2items
| |||||||||
Citation | Journal: Nat Struct Mol Biol / Year: 2020Title: FANCD2-FANCI is a clamp stabilized on DNA by monoubiquitination of FANCD2 during DNA repair. Authors: Pablo Alcón / Shabih Shakeel / Zhuo A Chen / Juri Rappsilber / Ketan J Patel / Lori A Passmore / ![]() Abstract: Vertebrate DNA crosslink repair excises toxic replication-blocking DNA crosslinks. Numerous factors involved in crosslink repair have been identified, and mutations in their corresponding genes cause ...Vertebrate DNA crosslink repair excises toxic replication-blocking DNA crosslinks. Numerous factors involved in crosslink repair have been identified, and mutations in their corresponding genes cause Fanconi anemia (FA). A key step in crosslink repair is monoubiquitination of the FANCD2-FANCI heterodimer, which then recruits nucleases to remove the DNA lesion. Here, we use cryo-EM to determine the structures of recombinant chicken FANCD2 and FANCI complexes. FANCD2-FANCI adopts a closed conformation when the FANCD2 subunit is monoubiquitinated, creating a channel that encloses double-stranded DNA (dsDNA). Ubiquitin is positioned at the interface of FANCD2 and FANCI, where it acts as a covalent molecular pin to trap the complex on DNA. In contrast, isolated FANCD2 is a homodimer that is unable to bind DNA, suggestive of an autoinhibitory mechanism that prevents premature activation. Together, our work suggests that FANCD2-FANCI is a clamp that is locked onto DNA by ubiquitin, with distinct interfaces that may recruit other DNA repair factors. | |||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 6tnf.cif.gz | 321.9 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb6tnf.ent.gz | 201.7 KB | Display | PDB format |
| PDBx/mmJSON format | 6tnf.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/tn/6tnf ftp://data.pdbj.org/pub/pdb/validation_reports/tn/6tnf | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 10531MC ![]() 6tngC ![]() 6tniC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | |
| EM raw data | EMPIAR-10611 (Title: Unaligned movies for ubFANCD2-FANCI + DNA / Data size: 4.5 TB / Data #1: Unaligned movies [micrographs - multiframe] / Data #2: Unaligned movies [micrographs - multiframe]) |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
| #1: Protein | Mass: 160932.328 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() | ||
|---|---|---|---|
| #2: Protein | Mass: 149458.297 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() | ||
| #3: Protein | Mass: 8576.831 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: UBC / Production host: ![]() | ||
| #4: DNA chain | Mass: 5898.203 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: An idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides ...Details: An idealized dsDNA of 33 bp of arbitrary sequence was placed and refined into the EM density but the following DNA sequences were used in the sample preparation by annealing oligonucleotides X1, X2, X3, X4, X5, X6: X1: GCGCACCAAGAGATACGCGGTCGAATGCCGAGTAGCCATCAGCG X2: ACCATGCAGCTACTCGGCATTCGACCGCGTATCTGGCGACTACG X3: TATCTCTTGGTGCGC X4: CGCTGATGGCTACTC X5: CGTAGTCGCCAGATA X6: GAGTAGCTGCATGGT Source: (synth.) synthetic construct (others) Has ligand of interest | N | |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| |||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: 0.3 MDa / Experimental value: NO | |||||||||||||||||||||||||||||||||||
| Source (natural) |
| |||||||||||||||||||||||||||||||||||
| Source (recombinant) |
| |||||||||||||||||||||||||||||||||||
| Buffer solution | pH: 8 Details: 50 mM HEPES, 100 mM imidazole, 150 mM NaCl, 1 mM TCEP | |||||||||||||||||||||||||||||||||||
| Specimen | Conc.: 0.3 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | |||||||||||||||||||||||||||||||||||
| Specimen support | Grid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil | |||||||||||||||||||||||||||||||||||
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277.15 K |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 3500 nm / Nominal defocus min: 1800 nm / Cs: 2.7 mm / C2 aperture diameter: 50 µm / Alignment procedure: COMA FREE |
| Specimen holder | Cryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
| Image recording | Electron dose: 70 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) |
| EM imaging optics | Energyfilter slit width: 20 eV |
-
Processing
| EM software |
| ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||||||||||||||
| Particle selection | Num. of particles selected: 2500000 | ||||||||||||||||||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.8 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 146245 / Symmetry type: POINT | ||||||||||||||||||||||||||||||||||||||||
| Atomic model building | Protocol: OTHER / Space: REAL | ||||||||||||||||||||||||||||||||||||||||
| Atomic model building |
|
Movie
Controller
About Yorodumi




Homo sapiens (human)
United Kingdom, 2items
Citation
UCSF Chimera












PDBj
























































