[English] 日本語
Yorodumi
- PDB-8q5i: Structure of Candida albicans 80S ribosome in complex with cephaeline -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8q5i
TitleStructure of Candida albicans 80S ribosome in complex with cephaeline
Components
  • (40S ribosomal protein ...) x 23
  • (60S ribosomal protein ...) x 37
  • (Ribosomal protein ...) x 10
  • 18S ribosomal RNA
  • 25S rRNA
  • 5.8S rRNA
  • 5S
  • DNA (5'-R(P*GP*GP*CP*AP*G)-3')
  • Mixture of endogenous E-tRNAs
KeywordsRIBOSOME / Candida albicans / cephaeline
Function / homology
Function and homology information


yeast-form cell wall / hyphal cell wall / pre-mRNA 5'-splice site binding / negative regulation of mRNA splicing, via spliceosome / protein-RNA complex assembly / ribosomal subunit export from nucleus / maturation of LSU-rRNA / cytosolic ribosome / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / small-subunit processome ...yeast-form cell wall / hyphal cell wall / pre-mRNA 5'-splice site binding / negative regulation of mRNA splicing, via spliceosome / protein-RNA complex assembly / ribosomal subunit export from nucleus / maturation of LSU-rRNA / cytosolic ribosome / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / small-subunit processome / maintenance of translational fidelity / rRNA processing / large ribosomal subunit / ribosomal small subunit assembly / large ribosomal subunit rRNA binding / small ribosomal subunit / 5S rRNA binding / cytosolic small ribosomal subunit / ribosomal large subunit assembly / cytoplasmic translation / cytosolic large ribosomal subunit / rRNA binding / ribosome / structural constituent of ribosome / translation / ribonucleoprotein complex / cell surface / RNA binding / zinc ion binding / metal ion binding / cytosol / cytoplasm
Similarity search - Function
: / : / Ribosomal protein S26e signature. / Ribosomal protein L41 / Ribosomal protein L41 / Ribosomal protein S26e / Ribosomal protein S21e, conserved site / Ribosomal protein S26e superfamily / Ribosomal protein S26e / Ribosomal protein S21e signature. ...: / : / Ribosomal protein S26e signature. / Ribosomal protein L41 / Ribosomal protein L41 / Ribosomal protein S26e / Ribosomal protein S21e, conserved site / Ribosomal protein S26e superfamily / Ribosomal protein S26e / Ribosomal protein S21e signature. / Ribosomal protein S5, eukaryotic/archaeal / Ribosomal protein L29e / Ribosomal L29e protein family / Ribosomal protein L13e, conserved site / Ribosomal protein L13e signature. / Ribosomal protein S21e / Ribosomal protein S21e superfamily / Ribosomal protein S21e / Ribosomal protein S2, eukaryotic / Ribosomal protein L22e / Ribosomal protein L22e superfamily / Ribosomal L22e protein family / Ribosomal protein L38e / Ribosomal protein L38e superfamily / Ribosomal L38e protein family / 40S Ribosomal protein S10 / Ribosomal protein S10, eukaryotic/archaeal / Ribosomal protein L27e, conserved site / Ribosomal protein L27e signature. / Ribosomal protein L44e signature. / Plectin/S10, N-terminal / Ribosomal protein L10e, conserved site / Plectin/S10 domain / Ribosomal protein L10e signature. / Ribosomal protein L10e / Ribosomal protein L13e / Ribosomal protein L13e / Ribosomal protein L19, eukaryotic / Ribosomal protein S2, eukaryotic/archaeal / Ribosomal protein S8e subdomain, eukaryotes / Ribosomal protein S17e, conserved site / Ribosomal protein S17e signature. / 60S ribosomal protein L18a/ L20, eukaryotes / Ribosomal protein S30 / : / Ribosomal protein S30 / 40S ribosomal protein S29/30S ribosomal protein S14 type Z / : / Ribosomal protein S7e signature. / Ribosomal protein L24e, conserved site / Ribosomal protein L19/L19e conserved site / Ribosomal protein L19e signature. / Ribosomal protein L24e signature. / Ribosomal protein L44e / Ribosomal protein L44 / Ribosomal protein S3, eukaryotic/archaeal / Ribosomal protein L34e, conserved site / Ribosomal protein L34e signature. / Ribosomal protein L5 eukaryotic, C-terminal / Ribosomal L18 C-terminal region / : / Ribosomal protein L30e signature 1. / Ribosomal protein L6e signature. / 50S ribosomal protein L18Ae/60S ribosomal protein L20 and L18a / Ribosomal protein S19e / Ribosomal protein S3Ae, conserved site / Ribosomal protein S19e / Ribosomal protein S3Ae signature. / Ribosomal_S19e / Ribosomal protein S27e signature. / Ribosomal protein 50S-L18Ae/60S-L20/60S-L18A / Ribosomal L40e family / Ribosomal proteins 50S-L18Ae/60S-L20/60S-L18A / Ribosomal protein S4e, N-terminal, conserved site / Ribosomal protein S4e signature. / Ribosomal_L40e / Ribosomal protein L40e / 40S ribosomal protein S4, C-terminal domain / Ribosomal protein L40e superfamily / 40S ribosomal protein S4 C-terminus / Ribosomal protein L23/L25, N-terminal / Ribosomal protein L23, N-terminal domain / Ribosomal protein 60S L18 and 50S L18e / Ribosomal protein L30e signature 2. / Ribosomal protein S8e, conserved site / Eukaryotic Ribosomal Protein L27, KOW domain / Ribosomal protein S8e signature. / Ribosomal protein L30e, conserved site / Ribosomal protein S19A/S15e / Ribosomal protein L27e / Ribosomal protein L27e superfamily / Ribosomal L27e protein family / Ribosomal protein L36e signature. / Ribosomal protein L18/L18-A/B/e, conserved site / Ribosomal protein L18e signature. / Ribosomal protein L39e, conserved site / Ribosomal protein L39e signature. / Ribosomal protein S17e / Ribosomal protein S17e-like superfamily / Ribosomal S17
Similarity search - Domain/homology
Cephaeline / SPERMIDINE / SPERMINE (FULLY PROTONATED FORM) / : / : / : / : / RNA / RNA (> 10) / RNA (> 100) ...Cephaeline / SPERMIDINE / SPERMINE (FULLY PROTONATED FORM) / : / : / : / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Small ribosomal subunit protein eS4 / Large ribosomal subunit protein eL37 / Large ribosomal subunit protein eL38 / Small ribosomal subunit protein uS19 / Large ribosomal subunit protein eL19 / Large ribosomal subunit protein eL40 / Large ribosomal subunit protein eL22 / Large ribosomal subunit protein eL30 / Small ribosomal subunit protein uS17 / Large ribosomal subunit protein eL43 / Small ribosomal subunit protein eS30 / Small ribosomal subunit protein uS14 / 60S ribosomal protein L42-B / Ribosomal protein S7 / 40S ribosomal protein S17-B / 40S ribosomal protein S26 / Ribosomal protein L22 / 60S ribosomal protein L7-A / 60S ribosomal protein L28 / 60S ribosomal protein L33-A / 40S ribosomal protein S27 / 40S ribosomal protein S10-A / Ribosomal protein S10 / 40S ribosomal protein S3 / 40S ribosomal protein S6 / Ribosomal protein L13 / Ribosomal protein S5 / 60S ribosomal protein L20 / 40S ribosomal protein S28-B / 60S ribosomal protein L8 / Small ribosomal subunit protein eS1 / Small ribosomal subunit protein uS2 / 40S ribosomal protein S24 / 60S ribosomal protein L9-B / 60S ribosomal protein L23-A / 60S ribosomal protein L24-A / 60S ribosomal protein L18-A / 40S ribosomal protein S19-A / 40S ribosomal protein S7 / 60S ribosomal protein L29 / 40S ribosomal protein S22-A / 40S ribosomal protein S8 / Ribosomal protein S23 (S12) / 40S ribosomal protein S14-A / 60S ribosomal protein L34-B / 60S ribosomal protein L21-A / 60S ribosomal protein L31-B / 60S ribosomal protein L11-B / Ribosomal protein S4 / 60S ribosomal protein L2-B / 60S ribosomal protein L14-B / Ribosomal protein L24 / 40S ribosomal protein S18-B / 40S ribosomal protein S13 / 60S ribosomal protein L4-B / 60S ribosomal protein L13 / 60S ribosomal protein L25 / Ribosomal protein L29 / Large ribosomal subunit protein eL32 / Small ribosomal subunit protein uS9 / Large ribosomal subunit protein eL36 / Small ribosomal subunit protein eS32 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein eL15 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein uL16 / Large ribosomal subunit protein eL39 / 60S ribosomal protein L6 / Large ribosomal subunit protein eL27 / Small ribosomal subunit protein eS21
Similarity search - Component
Biological speciesCandida albicans (yeast)
Synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.45 Å
AuthorsKolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Guskov, A. / Yusupov, M.
Funding support France, 1items
OrganizationGrant numberCountry
Fondation pour la Recherche Medicale (FRM)FDT202204014886 France
CitationJournal: Biopolym Cell / Year: 2023
Title: Structural characterization of cephaeline binding to the eukaryotic ribosome using Cryo-Electron Microscopy
Authors: Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Wu, C. / Jenner, L. / Sachs, S.M. / Guskov, A. / Yusupov, M.
History
DepositionAug 9, 2023Deposition site: PDBE / Processing site: PDBE
Revision 1.0Sep 13, 2023Provider: repository / Type: Initial release
Revision 1.1Nov 1, 2023Group: Derived calculations / Structure summary / Category: chem_comp / entity / pdbx_entity_nonpoly
Item: _chem_comp.name / _chem_comp.pdbx_synonyms ..._chem_comp.name / _chem_comp.pdbx_synonyms / _entity.pdbx_description / _pdbx_entity_nonpoly.name
Revision 1.2Dec 20, 2023Group: Database references / Category: citation
Item: _citation.journal_abbrev / _citation.journal_id_CSD ..._citation.journal_abbrev / _citation.journal_id_CSD / _citation.pdbx_database_id_DOI / _citation.year
Revision 1.3Jan 31, 2024Group: Database references / Category: citation / Item: _citation.journal_abbrev / _citation.journal_id_ISSN

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
1: 25S rRNA
3: 5S
4: 5.8S rRNA
10: Mixture of endogenous E-tRNAs
j: 60S ribosomal protein L2-B
k: 60S ribosomal protein L3
l: 60S ribosomal protein L4-B
m: 60S ribosomal protein L5
n: 60S ribosomal protein L6
o: 60S ribosomal protein L7-A
p: 60S ribosomal protein L8
q: 60S ribosomal protein L9-B
r: 60S ribosomal protein L10
s: 60S ribosomal protein L11-B
t: 60S ribosomal protein L13
u: 60S ribosomal protein L14-B
v: 60S ribosomal protein L15-A
w: Ribosomal protein L13
x: Ribosomal protein L22
y: 60S ribosomal protein L18-A
z: 60S ribosomal protein L19-A
0: 60S ribosomal protein L20
2: 60S ribosomal protein L21-A
5: 60S ribosomal protein L22-B
6: 60S ribosomal protein L23-A
7: 60S ribosomal protein L24-A
8: 60S ribosomal protein L25
9: Ribosomal protein L24
AA: 60S ribosomal protein L27
AB: 60S ribosomal protein L28
AC: 60S ribosomal protein L29
AD: 60S ribosomal protein L30
AE: 60S ribosomal protein L31-B
AF: 60S ribosomal protein L32
AG: 60S ribosomal protein L33-A
AH: 60S ribosomal protein L34-B
AI: Ribosomal protein L29
AJ: 60S ribosomal protein L36
AK: 60S ribosomal protein L37-B
AL: 60S ribosomal protein L38
AM: 60S ribosomal protein L39
AN: 60S ribosomal protein L40-B
AO: 60S ribosomal protein L41
AP: 60S ribosomal protein L42-B
AQ: 60S ribosomal protein L43-A
A: 18S ribosomal RNA
B: 40S ribosomal protein S0
C: 40S ribosomal protein S1
D: Ribosomal protein S5
E: Ribosomal protein S3
F: 40S ribosomal protein S4
G: Ribosomal protein S7
H: 40S ribosomal protein S6
I: 40S ribosomal protein S7
J: 40S ribosomal protein S8
K: Ribosomal protein S4
L: 40S ribosomal protein S10-A
M: 40S ribosomal protein S11A
O: 40S ribosomal protein S13
P: 40S ribosomal protein S14-A
Q: 40S ribosomal protein S15
R: 40S ribosomal protein S16
S: 40S ribosomal protein S17-B
T: 40S ribosomal protein S18-B
U: 40S ribosomal protein S19-A
V: Ribosomal protein S10
W: 40S ribosomal protein S21
X: 40S ribosomal protein S22-A
Y: Ribosomal protein S23 (S12)
Z: 40S ribosomal protein S24
b: 40S ribosomal protein S26
c: 40S ribosomal protein S27
d: 40S ribosomal protein S28-B
e: 40S ribosomal protein S29A
f: 40S ribosomal protein S30
g: DNA (5'-R(P*GP*GP*CP*AP*G)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)3,022,582455
Polymers3,011,45376
Non-polymers11,129379
Water21,0051166
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
RNA chain , 6 types, 6 molecules 13410Ag

#1: RNA chain 25S rRNA


Mass: 1085306.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: 1305241335
#2: RNA chain 5S


Mass: 38943.129 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: X16634.1
#3: RNA chain 5.8S rRNA


Mass: 50683.906 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: OQ195134.1
#4: RNA chain Mixture of endogenous E-tRNAs


Mass: 4461.723 Da / Num. of mol.: 1 / Source method: isolated from a natural source
Details: The correct sequence should be GGCAGCAUAGCUCAGUUGGUUAGAGCGUAGGACUCAUAAGCCUAAGGUCACUGGUUCAAUUCCAGUUCUGCUACCA. Like GGCAG - gap - CUGCUACCA
Source: (natural) Candida albicans (yeast)
#46: RNA chain 18S ribosomal RNA


Mass: 575838.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: XR_002086442.1
#76: RNA chain DNA (5'-R(P*GP*GP*CP*AP*G)-3')


Mass: 1625.048 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Synthetic construct (others)

+
60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...

#5: Protein 60S ribosomal protein L2-B


Mass: 27366.596 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X9
#6: Protein 60S ribosomal protein L3


Mass: 44040.848 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q59LS1
#7: Protein 60S ribosomal protein L4-B


Mass: 39282.352 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F4H4
#8: Protein 60S ribosomal protein L5


Mass: 34557.977 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5AGZ7
#9: Protein 60S ribosomal protein L6


Mass: 19798.002 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P834
#10: Protein 60S ribosomal protein L7-A


Mass: 27446.961 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BVN2
#11: Protein 60S ribosomal protein L8


Mass: 28549.424 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C337
#12: Protein 60S ribosomal protein L9-B


Mass: 21755.217 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C3N3
#13: Protein 60S ribosomal protein L10


Mass: 25236.297 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5AIB8
#14: Protein 60S ribosomal protein L11-B


Mass: 19859.805 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1S5
#15: Protein 60S ribosomal protein L13


Mass: 23105.771 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F5V7
#16: Protein 60S ribosomal protein L14-B


Mass: 14748.476 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F332
#17: Protein 60S ribosomal protein L15-A


Mass: 24389.256 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5A6R1
#20: Protein 60S ribosomal protein L18-A


Mass: 20817.367 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C4Y1
#21: Protein 60S ribosomal protein L19-A


Mass: 21942.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PK40
#22: Protein 60S ribosomal protein L20


Mass: 20376.859 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZJ3
#23: Protein 60S ribosomal protein L21-A


Mass: 18049.945 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1C8
#24: Protein 60S ribosomal protein L22-B


Mass: 14107.862 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PM41
#25: Protein 60S ribosomal protein L23-A


Mass: 14508.019 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C444
#26: Protein 60S ribosomal protein L24-A


Mass: 17430.322 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C4U1
#27: Protein 60S ribosomal protein L25


Mass: 15873.581 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6A1
#29: Protein 60S ribosomal protein L27


Mass: 15551.407 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P843
#30: Protein 60S ribosomal protein L28


Mass: 16703.367 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BVY8
#31: Protein 60S ribosomal protein L29


Mass: 7135.336 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0G8
#32: Protein 60S ribosomal protein L30


Mass: 11520.384 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PM75
#33: Protein 60S ribosomal protein L31-B


Mass: 12993.149 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1M1
#34: Protein 60S ribosomal protein L32


Mass: 14993.688 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: O94008
#35: Protein 60S ribosomal protein L33-A


Mass: 12138.237 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BW57
#36: Protein 60S ribosomal protein L34-B


Mass: 13774.282 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F171
#38: Protein 60S ribosomal protein L36 / L39


Mass: 11096.161 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: P47834
#39: Protein 60S ribosomal protein L37-B


Mass: 10102.830 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PF45
#40: Protein 60S ribosomal protein L38


Mass: 8911.532 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PG16
#41: Protein 60S ribosomal protein L39 / L46


Mass: 6347.549 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q96W55
#42: Protein 60S ribosomal protein L40-B


Mass: 6078.412 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PL68
#43: Protein/peptide 60S ribosomal protein L41


Mass: 3396.280 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: P9WER7
#44: Protein 60S ribosomal protein L42-B


Mass: 12285.669 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BR69
#45: Protein 60S ribosomal protein L43-A


Mass: 10136.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PP14

-
Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY

#18: Protein Ribosomal protein L13


Mass: 22685.850 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ56
#19: Protein Ribosomal protein L22


Mass: 21002.861 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BUG0
#28: Protein Ribosomal protein L24


Mass: 14215.550 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3X2
#37: Protein Ribosomal protein L29


Mass: 14118.759 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6B7
#49: Protein Ribosomal protein S5


Mass: 26917.314 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ90
#50: Protein Ribosomal protein S3


Mass: 27313.570 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYS1
#52: Protein Ribosomal protein S7


Mass: 25319.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BS29
#56: Protein Ribosomal protein S4


Mass: 21765.146 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X2
#66: Protein Ribosomal protein S10


Mass: 13366.540 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYJ9
#69: Protein Ribosomal protein S23 (S12)


Mass: 16000.784 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V0

+
40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef

#47: Protein 40S ribosomal protein S0


Mass: 28759.307 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C395
#48: Protein 40S ribosomal protein S1


Mass: 29041.859 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C387
#51: Protein 40S ribosomal protein S4


Mass: 29435.354 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PCI6
#53: Protein 40S ribosomal protein S6


Mass: 27146.469 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ37
#54: Protein 40S ribosomal protein S7


Mass: 21285.818 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C655
#55: Protein 40S ribosomal protein S8


Mass: 22801.979 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0S0
#57: Protein 40S ribosomal protein S10-A


Mass: 13836.824 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BWQ8
#58: Protein 40S ribosomal protein S11A


Mass: 17638.648 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PN83
#59: Protein 40S ribosomal protein S13


Mass: 16976.787 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F4G0
#60: Protein 40S ribosomal protein S14-A


Mass: 14052.112 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V4
#61: Protein 40S ribosomal protein S15


Mass: 15967.796 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PK22
#62: Protein 40S ribosomal protein S16


Mass: 15769.456 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: O94017
#63: Protein 40S ribosomal protein S17-B


Mass: 15770.298 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BTR7
#64: Protein 40S ribosomal protein S18-B


Mass: 17023.785 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3Y8
#65: Protein 40S ribosomal protein S19-A


Mass: 16097.218 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C5L4
#67: Protein 40S ribosomal protein S21


Mass: 9652.814 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q9P844
#68: Protein 40S ribosomal protein S22-A


Mass: 14807.189 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0N4
#70: Protein 40S ribosomal protein S24


Mass: 15546.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C3K1
#71: Protein 40S ribosomal protein S26


Mass: 13606.099 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BTS1
#72: Protein 40S ribosomal protein S27


Mass: 8982.504 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BWE6
#73: Protein 40S ribosomal protein S28-B


Mass: 7536.808 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6C0A5
#74: Protein 40S ribosomal protein S29A


Mass: 6615.582 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PTR4
#75: Protein 40S ribosomal protein S30


Mass: 7127.437 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A1D8PSK2

-
Non-polymers , 6 types, 1545 molecules

#77: Chemical ChemComp-SPK / SPERMINE (FULLY PROTONATED FORM)


Mass: 206.372 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C10H30N4
#78: Chemical ChemComp-K16 / Cephaeline / (1~{R})-1-[[(2~{S},3~{R},11~{b}~{S})-3-ethyl-9,10-dimethoxy-2,3,4,6,7,11~{b}-hexahydro-1~{H}-benzo[a]quinolizin-2-yl]methyl]-7-methoxy-1,2,3,4-tetrahydroisoquinolin-6-ol


Mass: 466.612 Da / Num. of mol.: 3 / Source method: obtained synthetically / Formula: C28H38N2O4 / Feature type: SUBJECT OF INVESTIGATION
#79: Chemical ChemComp-SPD / SPERMIDINE / N-(2-AMINO-PROPYL)-1,4-DIAMINOBUTANE / PA(34)


Mass: 145.246 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C7H19N3
#80: Chemical...
ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 367 / Source method: obtained synthetically / Formula: Mg
#81: Chemical
ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 7 / Source method: isolated from a natural source / Formula: Zn
#82: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 1166 / Source method: isolated from a natural source / Formula: H2O

-
Details

Has ligand of interestY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Candida albicans 80S ribosome in complex with cephaeline
Type: RIBOSOME / Entity ID: #1-#75 / Source: NATURAL
Molecular weightExperimental value: NO
Source (natural)Organism: Candida albicans (yeast)
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 2400 nm / Nominal defocus min: 900 nm
Image recordingElectron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

EM softwareName: PHENIX / Version: 1.19rc4_4035: / Category: model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 2.45 Å / Resolution method: FSC 3 SIGMA CUT-OFF / Num. of particles: 254047 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.006202012
ELECTRON MICROSCOPYf_angle_d0.744296622
ELECTRON MICROSCOPYf_dihedral_angle_d15.19370705
ELECTRON MICROSCOPYf_chiral_restr0.04637135
ELECTRON MICROSCOPYf_plane_restr0.00719322

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more