[English] 日本語
![](img/lk-miru.gif)
- PDB-6nd4: Conformational switches control early maturation of the eukaryoti... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 6nd4 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Conformational switches control early maturation of the eukaryotic small ribosomal subunit | |||||||||
![]() |
| |||||||||
![]() | RIBOSOME / Ribosome assembly | |||||||||
Function / homology | ![]() RNA fragment catabolic process / rRNA 2'-O-methylation / t-UTP complex / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / Pwp2p-containing subcomplex of 90S preribosome / rRNA modification / histone H2AQ104 methyltransferase activity / snRNA binding / positive regulation of RNA binding ...RNA fragment catabolic process / rRNA 2'-O-methylation / t-UTP complex / Mpp10 complex / snoRNA guided rRNA 2'-O-methylation / Pwp2p-containing subcomplex of 90S preribosome / rRNA modification / histone H2AQ104 methyltransferase activity / snRNA binding / positive regulation of RNA binding / endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / septum digestion after cytokinesis / box C/D sno(s)RNA 3'-end processing / tRNA export from nucleus / rDNA heterochromatin / rRNA methyltransferase activity / endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / regulation of transcription by RNA polymerase I / positive regulation of rRNA processing / U4/U6 snRNP / O-methyltransferase activity / SUMOylation of RNA binding proteins / sno(s)RNA-containing ribonucleoprotein complex / protein localization to nucleolus / U4 snRNA binding / box C/D methylation guide snoRNP complex / rRNA methylation / U4 snRNP / U3 snoRNA binding / preribosome, small subunit precursor / establishment of cell polarity / snoRNA binding / positive regulation of transcription by RNA polymerase I / precatalytic spliceosome / Major pathway of rRNA processing in the nucleolus and cytosol / spliceosomal complex assembly / Cajal body / endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / U4/U6 x U5 tri-snRNP complex / RNA endonuclease activity / Transferases; Transferring one-carbon groups; Methyltransferases / 90S preribosome / maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / maturation of LSU-rRNA / maturation of SSU-rRNA / small-subunit processome / spliceosomal complex / mRNA splicing, via spliceosome / rRNA processing / ribosomal small subunit biogenesis / ribosomal small subunit assembly / small ribosomal subunit / cytosolic large ribosomal subunit / tRNA binding / rRNA binding / structural constituent of ribosome / mRNA binding / nucleolus / mitochondrion / RNA binding / nucleoplasm / identical protein binding / nucleus / cytoplasm Similarity search - Function | |||||||||
Biological species | ![]() ![]() | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.3 Å | |||||||||
![]() | Hunziker, M. / Barandun, J. / Klinge, S. | |||||||||
Funding support | ![]() ![]()
| |||||||||
![]() | ![]() Title: Conformational switches control early maturation of the eukaryotic small ribosomal subunit. Authors: Mirjam Hunziker / Jonas Barandun / Olga Buzovetsky / Caitlin Steckler / Henrik Molina / Sebastian Klinge / ![]() Abstract: Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent ...Eukaryotic ribosome biogenesis is initiated with the transcription of pre-ribosomal RNA at the 5' external transcribed spacer, which directs the early association of assembly factors but is absent from the mature ribosome. The subsequent co-transcriptional association of ribosome assembly factors with pre-ribosomal RNA results in the formation of the small subunit processome. Here we show that stable rRNA domains of the small ribosomal subunit can independently recruit their own biogenesis factors in vivo. The final assembly and compaction of the small subunit processome requires the presence of the 5' external transcribed spacer RNA and all ribosomal RNA domains. Additionally, our cryo-electron microscopy structure of the earliest nucleolar pre-ribosomal assembly - the 5' external transcribed spacer ribonucleoprotein - provides a mechanism for how conformational changes in multi-protein complexes can be employed to regulate the accessibility of binding sites and therefore define the chronology of maturation events during early stages of ribosome assembly. | |||||||||
History |
|
-
Structure visualization
Movie |
![]() |
---|---|
Structure viewer | Molecule: ![]() ![]() |
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 1.8 MB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 1.2 MB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.1 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.1 MB | Display | |
Data in XML | ![]() | 203.7 KB | Display | |
Data in CIF | ![]() | 364.9 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 0441MC M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-RNA chain , 3 types, 3 molecules 012
#1: RNA chain | Mass: 220317.000 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() ![]() |
---|---|
#2: RNA chain | Mass: 3727.073 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() ![]() |
#3: RNA chain | Mass: 46932.852 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() ![]() |
+Protein , 24 types, 26 molecules HIJKLMNOPQRSTUWZADabcdefgl
-Protein/peptide , 1 types, 1 molecules x
#28: Protein/peptide | Mass: 2060.531 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() ![]() |
---|
-Details
Sequence details | The complete sample sequence of 5'ETS rRNA is AUGCGAAAGCAGUUGAAGACAAGUUCGAAAAGAGUUUGGAAACGAAUUCG ...The complete sample sequence of 5'ETS rRNA is AUGCGAAAGC |
---|