[English] 日本語
Yorodumi
- PDB-4v7c: Structure of the Ribosome with Elongation Factor G Trapped in the... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 4v7c
TitleStructure of the Ribosome with Elongation Factor G Trapped in the Pre-Translocation State (pre-translocation 70S*tRNA structure)
Components
  • (30S ribosomal protein ...) x 20
  • (50S ribosomal protein ...) x 31
  • 16S ribosomal RNA
  • 23S ribosomal RNA
  • 5S ribosomal RNA
  • mRNA
  • tRNA
  • viomycin
KeywordsTRANSLATION / EF-G / single particle analysis / pre-translocation translation complex / viomycin
Function / homology
Function and homology information


stringent response / ornithine decarboxylase inhibitor activity / transcription antitermination factor activity, RNA binding / misfolded RNA binding / Group I intron splicing / RNA folding / transcriptional attenuation / endoribonuclease inhibitor activity / positive regulation of ribosome biogenesis / RNA-binding transcription regulator activity ...stringent response / ornithine decarboxylase inhibitor activity / transcription antitermination factor activity, RNA binding / misfolded RNA binding / Group I intron splicing / RNA folding / transcriptional attenuation / endoribonuclease inhibitor activity / positive regulation of ribosome biogenesis / RNA-binding transcription regulator activity / translational termination / negative regulation of cytoplasmic translation / four-way junction DNA binding / DnaA-L2 complex / translation repressor activity / negative regulation of translational initiation / regulation of mRNA stability / negative regulation of DNA-templated DNA replication initiation / mRNA regulatory element binding translation repressor activity / positive regulation of RNA splicing / assembly of large subunit precursor of preribosome / cytosolic ribosome assembly / response to reactive oxygen species / regulation of DNA-templated transcription elongation / ribosome assembly / transcription elongation factor complex / transcription antitermination / DNA endonuclease activity / regulation of cell growth / DNA-templated transcription termination / response to radiation / maintenance of translational fidelity / mRNA 5'-UTR binding / regulation of translation / large ribosomal subunit / ribosome biogenesis / transferase activity / ribosome binding / ribosomal small subunit biogenesis / ribosomal small subunit assembly / 5S rRNA binding / ribosomal large subunit assembly / small ribosomal subunit / small ribosomal subunit rRNA binding / large ribosomal subunit rRNA binding / cytosolic small ribosomal subunit / cytosolic large ribosomal subunit / cytoplasmic translation / tRNA binding / negative regulation of translation / rRNA binding / structural constituent of ribosome / ribosome / translation / response to antibiotic / negative regulation of DNA-templated transcription / mRNA binding / DNA binding / RNA binding / zinc ion binding / membrane / cytosol / cytoplasm
Similarity search - Function
Ribosomal protein L1, bacterial-type / Ribosomal protein L10, eubacterial, conserved site / Ribosomal protein L10 signature. / Ribosomal protein L10 / : / Ribosomal protein L1, conserved site / Ribosomal protein L1 signature. / Ribosomal protein L1 / Ribosomal protein L1, 3-layer alpha/beta-sandwich / Ribosomal protein L1-like ...Ribosomal protein L1, bacterial-type / Ribosomal protein L10, eubacterial, conserved site / Ribosomal protein L10 signature. / Ribosomal protein L10 / : / Ribosomal protein L1, conserved site / Ribosomal protein L1 signature. / Ribosomal protein L1 / Ribosomal protein L1, 3-layer alpha/beta-sandwich / Ribosomal protein L1-like / Ribosomal protein L1/ribosomal biogenesis protein / Ribosomal protein L1p/L10e family / Ribosomal protein L11, bacterial-type / Ribosomal protein S21, conserved site / Ribosomal protein S21 signature. / Ribosomal protein L25, short-form / Ribosomal protein S14, bacterial/plastid / Ribosomal protein S21 superfamily / Ribosomal protein S21 / Ribosomal protein S16, conserved site / Ribosomal protein S16 signature. / Ribosomal protein S21 / Ribosomal protein L11, conserved site / Ribosomal protein L11 signature. / Ribosomal protein L10-like domain superfamily / Ribosomal protein L10P / Ribosomal protein L10 / Ribosomal protein L16 signature 1. / Ribosomal protein L21, conserved site / Ribosomal protein L21 signature. / Ribosomal protein L16 signature 2. / Ribosomal protein L16, conserved site / Ribosomal protein L6, conserved site / Ribosomal protein L6 signature 1. / Ribosomal protein L9 signature. / Ribosomal protein L9, bacteria/chloroplast / Ribosomal protein L9, C-terminal / Ribosomal protein L9, C-terminal domain / : / Ribosomal protein L9, C-terminal domain superfamily / Ribosomal protein L11, N-terminal / Ribosomal protein L11, N-terminal domain / Ribosomal protein L17 signature. / Ribosomal protein L11/L12 / Ribosomal protein L11, C-terminal / Ribosomal protein L11, C-terminal domain superfamily / Ribosomal protein L11/L12, N-terminal domain superfamily / Ribosomal protein L11/L12 / Ribosomal protein L11, RNA binding domain / Ribosomal L25p family / Ribosomal protein L25 / Ribosomal protein L36 signature. / Ribosomal protein L32p, bacterial type / Ribosomal protein L25/Gln-tRNA synthetase, N-terminal / Ribosomal protein L28/L24 superfamily / Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain superfamily / Ribosomal protein L9 / : / Ribosomal protein L9, N-terminal domain superfamily / Ribosomal protein L9, N-terminal / Ribosomal protein L9, N-terminal domain / Ribosomal protein L33, conserved site / Ribosomal protein L33 signature. / Ribosomal protein L35, conserved site / Ribosomal protein L35 signature. / Ribosomal protein L28 / Ribosomal protein L35, non-mitochondrial / Ribosomal protein L18, bacterial-type / : / Ribosomal protein S3, bacterial-type / Ribosomal protein S19, bacterial-type / Ribosomal protein L6, bacterial-type / Ribosomal protein S13, bacterial-type / Ribosomal protein S6, conserved site / Ribosomal protein S6 signature. / Ribosomal protein L9/RNase H1, N-terminal / Ribosomal protein S7, bacterial/organellar-type / Ribosomal protein S11, bacterial-type / Ribosomal protein S20 / Ribosomal protein S20 superfamily / Ribosomal protein S20 / Ribosomal protein S4, bacterial-type / Ribosomal protein L5, bacterial-type / 30S ribosomal protein S17 / Ribosomal protein S5, bacterial-type / Ribosomal protein L36 / Ribosomal protein L36 superfamily / Ribosomal protein L36 / Ribosomal protein L19, conserved site / Ribosomal protein L19 signature. / Ribosomal protein L27, conserved site / Ribosomal protein L27 signature. / Ribosomal protein S6, plastid/chloroplast / Ribosomal protein L20 signature. / Ribosomal protein L22, bacterial/chloroplast-type / Ribosomal protein S2, bacteria/mitochondria/plastid / Ribosomal protein L14P, bacterial-type / Ribosomal protein L34, conserved site / Ribosomal protein L34 signature. / Ribosomal protein L2, bacterial/organellar-type
Similarity search - Domain/homology
Viomycin / : / : / : / : / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) ...Viomycin / : / : / : / : / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Small ribosomal subunit protein bS6 / Small ribosomal subunit protein uS7 / Large ribosomal subunit protein uL15 / Large ribosomal subunit protein uL10 / Large ribosomal subunit protein uL11 / Large ribosomal subunit protein bL19 / Large ribosomal subunit protein uL1 / Large ribosomal subunit protein bL20 / Large ribosomal subunit protein bL27 / Large ribosomal subunit protein bL28 / Large ribosomal subunit protein uL29 / Large ribosomal subunit protein bL32 / Large ribosomal subunit protein bL33 / Large ribosomal subunit protein bL34 / Large ribosomal subunit protein bL35 / Large ribosomal subunit protein bL36A / Large ribosomal subunit protein bL9 / Small ribosomal subunit protein uS10 / Small ribosomal subunit protein uS11 / Small ribosomal subunit protein uS12 / Small ribosomal subunit protein uS13 / Small ribosomal subunit protein bS16 / Small ribosomal subunit protein bS18 / Small ribosomal subunit protein uS19 / Small ribosomal subunit protein bS20 / Small ribosomal subunit protein uS2 / Small ribosomal subunit protein uS3 / Small ribosomal subunit protein uS4 / Small ribosomal subunit protein uS5 / Small ribosomal subunit protein uS8 / Small ribosomal subunit protein uS9 / Large ribosomal subunit protein uL13 / Large ribosomal subunit protein uL14 / Large ribosomal subunit protein uL16 / Large ribosomal subunit protein uL23 / Small ribosomal subunit protein uS15 / Large ribosomal subunit protein bL17 / Large ribosomal subunit protein bL21 / Large ribosomal subunit protein uL30 / Large ribosomal subunit protein uL6 / Small ribosomal subunit protein uS14 / Small ribosomal subunit protein uS17 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein uL2 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein uL24 / Large ribosomal subunit protein uL4 / Large ribosomal subunit protein uL22 / Large ribosomal subunit protein uL5 / Small ribosomal subunit protein bS21 / Large ribosomal subunit protein bL25
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
Streptomyces (bacteria)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 7.6 Å
AuthorsBrilot, A.F. / Korostelev, A.A. / Ermolenko, D.N. / Grigorieff, N.
CitationJournal: Proc Natl Acad Sci U S A / Year: 2013
Title: Structure of the ribosome with elongation factor G trapped in the pretranslocation state.
Authors: Axel F Brilot / Andrei A Korostelev / Dmitri N Ermolenko / Nikolaus Grigorieff /
Abstract: During protein synthesis, tRNAs and their associated mRNA codons move sequentially on the ribosome from the A (aminoacyl) site to the P (peptidyl) site to the E (exit) site in a process catalyzed by ...During protein synthesis, tRNAs and their associated mRNA codons move sequentially on the ribosome from the A (aminoacyl) site to the P (peptidyl) site to the E (exit) site in a process catalyzed by a universally conserved ribosome-dependent GTPase [elongation factor G (EF-G) in prokaryotes and elongation factor 2 (EF-2) in eukaryotes]. Although the high-resolution structure of EF-G bound to the posttranslocation ribosome has been determined, the pretranslocation conformation of the ribosome bound with EF-G and A-site tRNA has evaded visualization owing to the transient nature of this state. Here we use electron cryomicroscopy to determine the structure of the 70S ribosome with EF-G, which is trapped in the pretranslocation state using antibiotic viomycin. Comparison with the posttranslocation ribosome shows that the small subunit of the pretranslocation ribosome is rotated by ∼12° relative to the large subunit. Domain IV of EF-G is positioned in the cleft between the body and head of the small subunit outwardly of the A site and contacts the A-site tRNA. Our findings suggest a model in which domain IV of EF-G promotes the translocation of tRNA from the A to the P site as the small ribosome subunit spontaneously rotates back from the hybrid, rotated state into the nonrotated posttranslocation state.
History
DepositionNov 20, 2013Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jul 9, 2014Provider: repository / Type: Initial release
SupersessionDec 10, 2014ID: 3J5T, 3J5U
Revision 1.1Dec 10, 2014Group: Other
Revision 1.2Apr 15, 2015Group: Other
Revision 1.3Jul 18, 2018Group: Data collection / Category: em_software / Item: _em_software.image_processing_id / _em_software.name
Revision 1.4Dec 18, 2019Group: Derived calculations / Other / Category: atom_sites / struct_conn
Item: _atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] ..._atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] / _atom_sites.fract_transf_matrix[3][3] / _struct_conn.pdbx_leaving_atom_flag
Revision 1.5Mar 26, 2025Group: Data collection / Database references ...Data collection / Database references / Derived calculations / Refinement description / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / em_3d_fitting_list / pdbx_entry_details / pdbx_initial_refinement_model / pdbx_modification_feature / struct_conn
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _em_3d_fitting_list.accession_code / _em_3d_fitting_list.initial_refinement_model_id / _em_3d_fitting_list.source_name / _em_3d_fitting_list.type / _pdbx_entry_details.has_protein_modification / _struct_conn.pdbx_dist_value / _struct_conn.pdbx_leaving_atom_flag / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-5799
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
AA: 16S ribosomal RNA
AB: 30S ribosomal protein S2
AC: 30S ribosomal protein S3
AD: 30S ribosomal protein S4
AE: 30S ribosomal protein S5
AF: 30S ribosomal protein S6
AG: 30S ribosomal protein S7
AH: 30S ribosomal protein S8
AI: 30S ribosomal protein S9
AJ: 30S ribosomal protein S10
AK: 30S ribosomal protein S11
AL: 30S ribosomal protein S12
AM: 30S ribosomal protein S13
AN: 30S ribosomal protein S14
AO: 30S ribosomal protein S15
AP: 30S ribosomal protein S16
AQ: 30S ribosomal protein S17
AR: 30S ribosomal protein S18
AS: 30S ribosomal protein S19
AT: 30S ribosomal protein S20
AU: 30S ribosomal protein S21
AV: tRNA
AW: tRNA
AX: mRNA
AY: viomycin
BA: 23S ribosomal RNA
BB: 5S ribosomal RNA
BC: 50S ribosomal protein L1
BD: 50S ribosomal protein L2
BE: 50S ribosomal protein L3
BF: 50S ribosomal protein L4
BG: 50S ribosomal protein L5
BH: 50S ribosomal protein L6
BI: 50S ribosomal protein L9
BJ: 50S ribosomal protein L10
BK: 50S ribosomal protein L11
BL: 50S ribosomal protein L13
BM: 50S ribosomal protein L14
BN: 50S ribosomal protein L15
BO: 50S ribosomal protein L16
BP: 50S ribosomal protein L17
BQ: 50S ribosomal protein L18
BR: 50S ribosomal protein L19
BS: 50S ribosomal protein L20
BT: 50S ribosomal protein L21
BU: 50S ribosomal protein L22
BV: 50S ribosomal protein L23
BW: 50S ribosomal protein L24
BX: 50S ribosomal protein L25
BY: 50S ribosomal protein L27
BZ: 50S ribosomal protein L28
B1: 50S ribosomal protein L29
B2: 50S ribosomal protein L30
B3: 50S ribosomal protein L32
B4: 50S ribosomal protein L33
B5: 50S ribosomal protein L34
B6: 50S ribosomal protein L35
B7: 50S ribosomal protein L36
hetero molecules


Theoretical massNumber of molelcules
Total (without water)2,239,89359
Polymers2,239,82858
Non-polymers651
Water00
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
RNA chain , 5 types, 6 molecules AAAVAWAXBABB

#1: RNA chain 16S ribosomal RNA


Mass: 499690.031 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: J01695.2
#22: RNA chain tRNA


Mass: 24485.539 Da / Num. of mol.: 2 / Fragment: SEE REMARK 999 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: K-12 / References: GenBank: AP009048.1
#23: RNA chain mRNA


Mass: 5781.499 Da / Num. of mol.: 1 / Fragment: SEE REMARK 999 / Source method: obtained synthetically
#25: RNA chain 23S ribosomal RNA


Mass: 941306.188 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: 33357927
#26: RNA chain 5S ribosomal RNA


Mass: 38483.926 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: CP000948.1

-
30S ribosomal protein ... , 20 types, 20 molecules ABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAU

#2: Protein 30S ribosomal protein S2


Mass: 26650.475 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V0
#3: Protein 30S ribosomal protein S3


Mass: 25900.117 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V3
#4: Protein 30S ribosomal protein S4


Mass: 23383.002 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V8
#5: Protein 30S ribosomal protein S5


Mass: 17498.203 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W1
#6: Protein 30S ribosomal protein S6


Mass: 15211.058 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02358
#7: Protein 30S ribosomal protein S7


Mass: 19923.959 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02359
#8: Protein 30S ribosomal protein S8


Mass: 14015.361 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W7
#9: Protein 30S ribosomal protein S9


Mass: 14755.074 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7X3
#10: Protein 30S ribosomal protein S10


Mass: 11755.597 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R5
#11: Protein 30S ribosomal protein S11


Mass: 13739.778 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R9
#12: Protein 30S ribosomal protein S12


Mass: 13636.961 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S3
#13: Protein 30S ribosomal protein S13


Mass: 12997.271 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S9
#14: Protein 30S ribosomal protein S14


Mass: 11475.364 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG59
#15: Protein 30S ribosomal protein S15


Mass: 10159.621 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ4
#16: Protein 30S ribosomal protein S16


Mass: 9207.572 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T3
#17: Protein 30S ribosomal protein S17


Mass: 9593.296 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG63
#18: Protein 30S ribosomal protein S18


Mass: 8874.276 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T7
#19: Protein 30S ribosomal protein S19


Mass: 10324.160 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U3
#20: Protein 30S ribosomal protein S20


Mass: 9577.268 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U7
#21: Protein 30S ribosomal protein S21


Mass: 8392.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68679

+
50S ribosomal protein ... , 31 types, 31 molecules BCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZB1B2B3B4B5B6B7

#27: Protein 50S ribosomal protein L1


Mass: 24634.465 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L0
#28: Protein 50S ribosomal protein L2


Mass: 29792.424 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60422
#29: Protein 50S ribosomal protein L3


Mass: 22277.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60438
#30: Protein 50S ribosomal protein L4


Mass: 22121.566 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60723
#31: Protein 50S ribosomal protein L5


Mass: 20202.416 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P62399
#32: Protein 50S ribosomal protein L6


Mass: 18801.598 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG55
#33: Protein 50S ribosomal protein L9


Mass: 15789.020 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R1
#34: Protein 50S ribosomal protein L10


Mass: 17736.596 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J3
#35: Protein 50S ribosomal protein L11


Mass: 14763.165 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7J7
#36: Protein 50S ribosomal protein L13


Mass: 16050.606 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AA10
#37: Protein 50S ribosomal protein L14


Mass: 13565.067 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY3
#38: Protein 50S ribosomal protein L15


Mass: 15008.471 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02413
#39: Protein 50S ribosomal protein L16


Mass: 15312.269 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADY7
#40: Protein 50S ribosomal protein L17


Mass: 14393.657 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG44
#41: Protein 50S ribosomal protein L18


Mass: 12794.668 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0C018
#42: Protein 50S ribosomal protein L19


Mass: 13028.082 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7K6
#43: Protein 50S ribosomal protein L20


Mass: 13396.828 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L3
#44: Protein 50S ribosomal protein L21


Mass: 11586.374 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG48
#45: Protein 50S ribosomal protein L22


Mass: 12253.359 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P61175
#46: Protein 50S ribosomal protein L23


Mass: 11222.160 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ0
#47: Protein 50S ribosomal protein L24


Mass: 11208.054 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P60624
#48: Protein 50S ribosomal protein L25


Mass: 10713.465 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68919
#49: Protein 50S ribosomal protein L27


Mass: 9015.344 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7L8
#50: Protein 50S ribosomal protein L28


Mass: 8896.354 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M2
#51: Protein 50S ribosomal protein L29


Mass: 7286.464 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7M6
#52: Protein 50S ribosomal protein L30


Mass: 6423.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG51
#53: Protein 50S ribosomal protein L32


Mass: 6332.249 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N4
#54: Protein 50S ribosomal protein L33


Mass: 6257.436 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7N9
#55: Protein/peptide 50S ribosomal protein L34


Mass: 5397.463 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7P5
#56: Protein 50S ribosomal protein L35


Mass: 7181.835 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q1
#57: Protein/peptide 50S ribosomal protein L36


Mass: 4377.390 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7Q6

-
Protein/peptide / Non-polymers , 2 types, 2 molecules AY

#24: Protein/peptide viomycin


Type: Oligopeptide / Class: Antibiotic / Mass: 703.707 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Streptomyces (bacteria) / References: NOR: NOR00633, Viomycin
#58: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Zn

-
Details

Has protein modificationY
Sequence detailsTHE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS ...THE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS STUDY ARE MODELED AS TRNA-PHE AND AGGAGGUAAAAUUCUUCA, RESPECTIVELY, ACCORDING TO THE SEQUENCES IN THE CRYSTAL STRUCTURE USED AS A STARTING STRUCTURAL MODEL (PDB ENTRY 4GD1).

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeDetailsParent-ID
1Pre-translocation ribosome bound to A/P, P/E hybrid state tRNARIBOSOMESample was monodisperse.0
270S ribosomeRIBOSOME1
3Transfer RNA1
4Messenger RNA1
Molecular weightValue: 3 MDa / Experimental value: NO
Buffer solutionName: Polymix buffer / pH: 7.6
Details: 10 mM HEPES-KOH, 5 mM MgCl2, 90 mM NH4Cl, 2 mM spermidine, 0.1 mM spermine, 6 mM BME, 0.5 mM viomycin, 0.5 mM GTP, 0.5 mM fusidic acid
SpecimenConc.: 0.4 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportDetails: C-flat 1.2/1.3 holey carbon 400 mesh copper grid, glow discharged with a current of -20 mA for 45 seconds in an EMITECH K100X glow discharge unit
VitrificationInstrument: FEI VITROBOT MARK II / Cryogen name: ETHANE / Humidity: 95 %
Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side ...Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.
Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side ...Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane.

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS / Date: Nov 2, 2012
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 133333 X / Calibrated magnification: 134615 X / Nominal defocus max: 6950 nm / Nominal defocus min: 1150 nm / Cs: 0.01 mm / Astigmatism: Automatically corrected using FEI software / Camera length: 0 mm
Specimen holderSpecimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 30 e/Å2 / Film or detector model: FEI FALCON I (4k x 4k)
Image scansNum. digital images: 13341
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthRelative weight: 1

-
Processing

EM software
IDNameVersionCategory
1CTFFIND3CTF correction
2CNSmodel fitting
3UCSF Chimeramodel fitting
4EMAN23D reconstruction
5FREALIGN3D reconstruction
6IMAGIC3D reconstruction
7RSAMPLE3D reconstruction
CTF correctionDetails: CTFFIND3, FREALIGN per micrograph
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionMethod: Projection Matching / Resolution: 7.6 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 85115 / Nominal pixel size: 1.05 Å / Actual pixel size: 1.04 Å
Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification ...Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification performed by Frealign) (Single particle--Applied symmetry: C1)
Symmetry type: POINT
Atomic model buildingProtocol: RIGID BODY FIT / Space: REAL / Target criteria: Cross-correlation
Details: REFINEMENT PROTOCOL--rigid body DETAILS--Chain Y not used in refinement
Atomic model buildingPDB-ID: 4GD1

4gd1
PDB Unreleased entry


Accession code: 4GD1 / Source name: PDB / Type: experimental model
Refinement stepCycle: LAST
ProteinNucleic acidLigandSolventTotal
Num. atoms18591 36622 0 0 55213

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more