[English] 日本語
Yorodumi
- EMDB-3202: Cryo-EM structure of the E. coli replicative DNA polymerase compl... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: EMDB / ID: EMD-3202
TitleCryo-EM structure of the E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits)
Map dataE. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits)
Sample
  • Sample: DNA polymerase III catalytic complex
  • Protein or peptide: DNA polymerase III alpha
  • Protein or peptide: DNA polymerase III beta
  • Protein or peptide: DNA polymerase III epsilon
  • DNA: primer-template duplex DNA
KeywordsDNA replication / DNA polymerase III alpha / DNA polymerase III beta / DNA polymerase III epsilon
Function / homology
Function and homology information


DNA polymerase III, core complex / Hda-beta clamp complex / bacterial-type DNA replication / replication inhibiting complex / DNA replication proofreading / DNA polymerase III complex / lagging strand elongation / replisome / regulation of DNA-templated DNA replication initiation / exonuclease activity ...DNA polymerase III, core complex / Hda-beta clamp complex / bacterial-type DNA replication / replication inhibiting complex / DNA replication proofreading / DNA polymerase III complex / lagging strand elongation / replisome / regulation of DNA-templated DNA replication initiation / exonuclease activity / DNA strand elongation involved in DNA replication / leading strand elongation / error-prone translesion synthesis / 3'-5' exonuclease activity / negative regulation of DNA-templated DNA replication initiation / DNA-templated DNA replication / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / DNA replication / DNA damage response / protein homodimerization activity / DNA binding / metal ion binding / identical protein binding / cytoplasm / cytosol
Similarity search - Function
: / : / DNA polymerase III subunit alpha, C-terminal domain / DNA polymerase 3, epsilon subunit / DNA polymerase 3, epsilon subunit / DNA polymerase III epsilon subunit, exonuclease domain / Bacterial DNA polymerase III alpha subunit, thumb domain / DNA polymerase III, alpha subunit / DNA polymerase III, alpha subunit / Bacterial DNA polymerase III, alpha subunit, NTPase domain ...: / : / DNA polymerase III subunit alpha, C-terminal domain / DNA polymerase 3, epsilon subunit / DNA polymerase 3, epsilon subunit / DNA polymerase III epsilon subunit, exonuclease domain / Bacterial DNA polymerase III alpha subunit, thumb domain / DNA polymerase III, alpha subunit / DNA polymerase III, alpha subunit / Bacterial DNA polymerase III, alpha subunit, NTPase domain / DNA polymerase, helix-hairpin-helix motif / DNA polymerase III alpha subunit finger domain / Bacterial DNA polymerase III alpha NTPase domain / Helix-hairpin-helix motif / Bacterial DNA polymerase III alpha subunit finger domain / PHP domain / PHP domain / Polymerase/histidinol phosphatase, N-terminal / DNA polymerase alpha chain like domain / Polymerase/histidinol phosphatase-like / Exonuclease / DNA polymerase III, beta sliding clamp / DNA polymerase III, beta sliding clamp / DNA polymerase III, beta sliding clamp, N-terminal / DNA polymerase III, beta sliding clamp, C-terminal / DNA polymerase III, beta sliding clamp, central / DNA polymerase III beta subunit, N-terminal domain / DNA polymerase III beta subunit, central domain / DNA polymerase III beta subunit, C-terminal domain / DNA polymerase III beta subunit / Exonuclease, RNase T/DNA polymerase III / EXOIII / OB-fold nucleic acid binding domain, AA-tRNA synthetase-type / OB-fold nucleic acid binding domain / : / Ribonuclease H superfamily / Ribonuclease H-like superfamily / Nucleic acid-binding, OB-fold
Similarity search - Domain/homology
DNA polymerase III subunit epsilon / Beta sliding clamp / DNA polymerase III subunit alpha
Similarity search - Component
Biological speciesEscherichia coli (E. coli) / unidentified (others)
Methodsingle particle reconstruction / cryo EM / Resolution: 7.3 Å
AuthorsFernandez-Leiro R / Conrad J / Scheres HWS / Lamers MH
CitationJournal: Elife / Year: 2015
Title: cryo-EM structures of the replicative DNA polymerase reveal its dynamic interactions with the DNA sliding clamp, exonuclease and .
Authors: Rafael Fernandez-Leiro / Julian Conrad / Sjors Hw Scheres / Meindert H Lamers /
Abstract: The replicative DNA polymerase PolIIIα from is a uniquely fast and processive enzyme. For its activity it relies on the DNA sliding clamp β, the proofreading exonuclease ε and the C-terminal ...The replicative DNA polymerase PolIIIα from is a uniquely fast and processive enzyme. For its activity it relies on the DNA sliding clamp β, the proofreading exonuclease ε and the C-terminal domain of the clamp loader subunit τ. Due to the dynamic nature of the four-protein complex it has long been refractory to structural characterization. Here we present the 8 Å resolution cryo-electron microscopy structures of DNA-bound and DNA-free states of the PolIII-clamp-exonuclease-τ complex. The structures show how the polymerase is tethered to the DNA through multiple contacts with the clamp and exonuclease. A novel contact between the polymerase and clamp is made in the DNA bound state, facilitated by a large movement of the polymerase tail domain and τ. These structures provide crucial insights into the organization of the catalytic core of the replisome and form an important step towards determining the structure of the complete holoenzyme.
History
DepositionOct 20, 2015-
Header (metadata) releaseNov 4, 2015-
Map releaseNov 4, 2015-
UpdateDec 9, 2015-
Current statusDec 9, 2015Processing site: PDBe / Status: Released

-
Structure visualization

Movie
  • Surface view with section colored by density value
  • Surface level: 0.045
  • Imaged by UCSF Chimera
  • Download
  • Surface view colored by radius
  • Surface level: 0.045
  • Imaged by UCSF Chimera
  • Download
  • Surface view with fitted model
  • Atomic models: PDB-5fkw
  • Surface level: 0.045
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerEM map:
SurfViewMolmilJmol/JSmol
Supplemental images

Downloads & links

-
Map

FileDownload / File: emd_3202.map.gz / Format: CCP4 / Size: 7.8 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES)
AnnotationE. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits)
Projections & slices

Image control

Size
Brightness
Contrast
Others
AxesZ (Sec.)Y (Row.)X (Col.)
1.76 Å/pix.
x 128 pix.
= 225.28 Å
1.76 Å/pix.
x 128 pix.
= 225.28 Å
1.76 Å/pix.
x 128 pix.
= 225.28 Å

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider.

Voxel sizeX=Y=Z: 1.76 Å
Density
Contour LevelBy AUTHOR: 0.045 / Movie #1: 0.045
Minimum - Maximum-0.07079408 - 0.16256787
Average (Standard dev.)-0.00000347 (±0.0099889)
SymmetrySpace group: 1
Details

EMDB XML:

Map geometry
Axis orderXYZ
Origin000
Dimensions128128128
Spacing128128128
CellA=B=C: 225.28 Å
α=β=γ: 90.0 °

CCP4 map header:

modeImage stored as Reals
Å/pix. X/Y/Z1.761.761.76
M x/y/z128128128
origin x/y/z0.0000.0000.000
length x/y/z225.280225.280225.280
α/β/γ90.00090.00090.000
MAP C/R/S123
start NC/NR/NS000
NC/NR/NS128128128
D min/max/mean-0.0710.163-0.000

-
Supplemental data

-
Segmentation: mask for reconstructions

Annotationmask for reconstructions
Fileemd_3202_msk_1.map
Projections & Slices
AxesZYX

Projections

Slices (1/2)
Density Histograms

-
Supplemental map: emd 3202 half map 1.map

Fileemd_3202_half_map_1.map
Projections & Slices
AxesZYX

Projections

Slices (1/2)
Density Histograms

-
Supplemental map: emd 3202 half map 2.map

Fileemd_3202_half_map_2.map
Projections & Slices
AxesZYX

Projections

Slices (1/2)
Density Histograms

-
Sample components

-
Entire : DNA polymerase III catalytic complex

EntireName: DNA polymerase III catalytic complex
Components
  • Sample: DNA polymerase III catalytic complex
  • Protein or peptide: DNA polymerase III alpha
  • Protein or peptide: DNA polymerase III beta
  • Protein or peptide: DNA polymerase III epsilon
  • DNA: primer-template duplex DNA

-
Supramolecule #1000: DNA polymerase III catalytic complex

SupramoleculeName: DNA polymerase III catalytic complex / type: sample / ID: 1000
Details: Individual proteins purified individually and the complex was later assembled in vitro and purified over gel filtration DNA polymerase subunit tau is not visible in this map due to comformational heterogeneity
Oligomeric state: 1 DNA polymerase III alpha : 2 DNA polymerase III beta: 1 DNA polymerase III epsilon : 1 dsDNA
Number unique components: 5
Molecular weightTheoretical: 256 KDa

-
Macromolecule #1: DNA polymerase III alpha

MacromoleculeName: DNA polymerase III alpha / type: protein_or_peptide / ID: 1 / Name.synonym: dnaE
Details: amino acid residues 920-924 of E. coli PolIII alpha were changed by site directed mutagenesis from QADMF to QLDLF
Number of copies: 1 / Oligomeric state: 1 / Recombinant expression: Yes
Source (natural)Organism: Escherichia coli (E. coli) / Strain: K12
Molecular weightTheoretical: 132 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli) / Recombinant strain: BL21 (DE3) / Recombinant plasmid: pET3d
SequenceUniProtKB: DNA polymerase III subunit alpha
GO: DNA replication, DNA binding, DNA-directed DNA polymerase activity
InterPro: DNA polymerase III, alpha subunit

-
Macromolecule #2: DNA polymerase III beta

MacromoleculeName: DNA polymerase III beta / type: protein_or_peptide / ID: 2 / Name.synonym: DNA clamp / Number of copies: 1 / Oligomeric state: 2 / Recombinant expression: Yes
Source (natural)Organism: Escherichia coli (E. coli) / Strain: K12
Molecular weightTheoretical: 81 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli) / Recombinant strain: BL21 (DE3) / Recombinant plasmid: pET3d
SequenceUniProtKB: Beta sliding clamp / GO: DNA strand elongation involved in DNA replication / InterPro: DNA polymerase III, beta sliding clamp

-
Macromolecule #3: DNA polymerase III epsilon

MacromoleculeName: DNA polymerase III epsilon / type: protein_or_peptide / ID: 3 / Name.synonym: dnaQ
Details: amino acid residues 182-187 of E. coli PolIII epsilon were changed by site directed mutagenesis from QTSMAF to QLSLPL
Number of copies: 1 / Oligomeric state: 1 / Recombinant expression: Yes
Source (natural)Organism: Escherichia coli (E. coli) / Strain: K12
Molecular weightTheoretical: 27.3762 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli) / Recombinant strain: BL21 (DE3) / Recombinant plasmid: pET3d
SequenceUniProtKB: DNA polymerase III subunit epsilon / GO: exonuclease activity / InterPro: DNA polymerase 3, epsilon subunit

-
Macromolecule #4: primer-template duplex DNA

MacromoleculeName: primer-template duplex DNA / type: dna / ID: 4 / Name.synonym: dsDNA
Details: template strans has a 4 nucleotide overhang, sequence as follows: TCAGGAGTCCTTCGTCCTAGTACTACTCC
Classification: DNA / Structure: DOUBLE HELIX / Synthetic?: Yes
Source (natural)Organism: unidentified (others)
Molecular weightTheoretical: 15.5 KDa
SequenceString:
GGAGTAGTAC TAGGACGAAG GACTC

-
Experimental details

-
Structure determination

Methodcryo EM
Processingsingle particle reconstruction
Aggregation stateparticle

-
Sample preparation

Concentration1 mg/mL
BufferpH: 7.5
Details: 25 mM Hepes pH 7.5, 50 mM Potassium Glutamate, 3 mM Magnesium Acetate, 2 mM DTT
GridDetails: glow-discharged holey carbon cryo-EM grids (Quantifoil Cu R1.2/1.3 400 mesh)
VitrificationCryogen name: ETHANE / Chamber humidity: 100 % / Chamber temperature: 110 K / Instrument: FEI VITROBOT MARK III
Method: Prior to sample preparation 0.1 volumes of 0.05% Tween 20 were added to the sample 3 microliters were pipetted onto the grid and blotted for 4 seconds

-
Electron microscopy

MicroscopeFEI TITAN KRIOS
TemperatureMin: 80 K / Max: 90 K / Average: 85 K
Alignment procedureLegacy - Astigmatism: Objective lens astigmatism was corrected at 64,000 times magnification
DateMay 12, 2014
Image recordingCategory: CCD / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Digitization - Sampling interval: 5 µm / Number real images: 1350 / Average electron dose: 40 e/Å2 / Details: 20 frames/micrograph / Bits/pixel: 32
Electron beamAcceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
Electron opticsCalibrated magnification: 28409 / Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 2.7 mm / Nominal defocus max: 4.0 µm / Nominal defocus min: 2.0 µm / Nominal magnification: 64000
Sample stageSpecimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company

+
Image processing

DetailsParticles were selected using automated particle picking with RELION Initial model was calculated with EMAN2 2D classification, 3D classification and 3D refinement was performed with RELION
CTF correctionDetails: each particle
Final reconstructionApplied symmetry - Point group: C1 (asymmetric) / Resolution.type: BY AUTHOR / Resolution: 7.3 Å / Resolution method: OTHER / Software - Name: RELION, ctffind3, EMAN2
Details: Particle movement correction and b-factor weighting was performed with RELION
Number images used: 40582
Final two d classificationNumber classes: 200
FSC plot (resolution estimation)

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more