[English] 日本語
Yorodumi
- PDB-9yi8: Cryo-EM structure of yeast Mgm101 bound to apparent B-form DNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9yi8
TitleCryo-EM structure of yeast Mgm101 bound to apparent B-form DNA
Components
  • DNA (75+)
  • DNA (75-)
  • Mitochondrial genome maintenance protein MGM101
KeywordsDNA BINDING PROTEIN/DNA / Single strand annealing protein / SSAP / annealase / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


mitochondrial chromosome / recombinational repair / mitochondrial nucleoid / interstrand cross-link repair / single-stranded DNA binding / DNA repair / mitochondrion / DNA binding
Similarity search - Function
Mitochondrial genome maintenance protein Mgm101 / Mitochondrial genome maintenance MGM101
Similarity search - Domain/homology
DNA / DNA (> 10) / Mitochondrial genome maintenance protein MGM101
Similarity search - Component
Biological speciesSaccharomyces cerevisiae (brewer's yeast)
Inovirus M13
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.16 Å
AuthorsWheat, C.T. / Bell, C.E.
Funding support United States, 1items
OrganizationGrant numberCountry
National Science Foundation (NSF, United States)2212951 United States
CitationJournal: bioRxiv / Year: 2025
Title: Mechanism of single-strand annealing from native mass spectrometry and cryo-EM structures of RAD52 homolog Mgm101.
Authors: Carter T Wheat / Zihao Qi / Miqdad Hussain / Katerina Zakharova / Vicki H Wysocki / Charles E Bell /
Abstract: RAD52, the primary single-strand annealing (SSA) protein in humans, forms undecameric rings that bind ssDNA within a narrow, positively-charged groove. Whether RAD52 anneals two complementary ssDNAs ...RAD52, the primary single-strand annealing (SSA) protein in humans, forms undecameric rings that bind ssDNA within a narrow, positively-charged groove. Whether RAD52 anneals two complementary ssDNAs on the same ring in , or between two ring-ssDNA complexes in , is unknown. Here, we determined cryo-EM structures of Mgm101, a RAD52 homolog from yeast mitochondria, in complexes with ssDNA, a duplex intermediate of annealing, and B-form dsDNA product. In all states, Mgm101 forms a closed nonadecameric ring that binds the backbone of the first ssDNA at the base of the narrow groove. The second complementary strand binds directly on top of the first to form an extended, unwound, and circular duplex intermediate of annealing. The third complex captures apparent B-form DNA product bound to a novel β-hairpin motif located on top of the Mgm101 ring, above the primary DNA-binding groove. Mass photometry and native mass spectrometry confirm and further elucidate the complexes formed in solution. Altogether, our data reveal the full SSA pathway of Mgm101 and suggest it anneals two complementary ssDNAs on the same ring in . Structural conservation with RAD52 suggests it is likely to use a similar mechanism of annealing.
History
DepositionOct 1, 2025Deposition site: RCSB / Processing site: RCSB
Revision 1.0Nov 5, 2025Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Nov 5, 2025Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Dec 10, 2025Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
Y: DNA (75+)
Z: DNA (75-)
A: Mitochondrial genome maintenance protein MGM101
C: Mitochondrial genome maintenance protein MGM101
E: Mitochondrial genome maintenance protein MGM101
G: Mitochondrial genome maintenance protein MGM101
B: Mitochondrial genome maintenance protein MGM101
D: Mitochondrial genome maintenance protein MGM101
F: Mitochondrial genome maintenance protein MGM101
H: Mitochondrial genome maintenance protein MGM101
I: Mitochondrial genome maintenance protein MGM101
J: Mitochondrial genome maintenance protein MGM101
K: Mitochondrial genome maintenance protein MGM101
L: Mitochondrial genome maintenance protein MGM101
M: Mitochondrial genome maintenance protein MGM101
N: Mitochondrial genome maintenance protein MGM101
O: Mitochondrial genome maintenance protein MGM101
P: Mitochondrial genome maintenance protein MGM101
Q: Mitochondrial genome maintenance protein MGM101
R: Mitochondrial genome maintenance protein MGM101
S: Mitochondrial genome maintenance protein MGM101


Theoretical massNumber of molelcules
Total (without water)554,84321
Polymers554,84321
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: mass spectrometry, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: DNA chain DNA (75+)


Mass: 6258.394 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: The actual sequence is: TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAA
Source: (synth.) Inovirus M13
#2: DNA chain DNA (75-)


Mass: 6618.585 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: The actual sequence is: TTAAAACATGTTGAGCTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAA
Source: (synth.) Inovirus M13
#3: Protein
Mitochondrial genome maintenance protein MGM101


Mass: 28524.535 Da / Num. of mol.: 19
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Saccharomyces cerevisiae (brewer's yeast)
Gene: MGM101, MGM9, YJR144W, J2181 / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: P32787
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Cryo-EM structure of yeast Mgm101 bound to apparent B-form DNA
Type: COMPLEX / Entity ID: all / Source: RECOMBINANT
Molecular weightValue: 0.587 MDa / Experimental value: YES
Source (natural)Organism: Saccharomyces cerevisiae (brewer's yeast)
Source (recombinant)Organism: Escherichia coli BL21(DE3) (bacteria)
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN
Electron lensMode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm / Cs: 0.01 mm / C2 aperture diameter: 50 µm
Image recordingAverage exposure time: 2.6 sec. / Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of grids imaged: 1
EM imaging opticsEnergyfilter name: GIF Bioquantum / Energyfilter slit width: 20 eV

-
Processing

EM software
IDNameVersionCategory
1cryoSPARC4.6.2particle selection
2EPUimage acquisition
7UCSF ChimeraX1.9model fitting
9PHENIX1.21.2_5419model refinement
13cryoSPARC4.6.23D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 3.16 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 40203 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more