[English] 日本語
Yorodumi- PDB-9yi7: Cryo-EM structure of yeast Mgm101 bound to duplex DNA annealing i... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9yi7 | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of yeast Mgm101 bound to duplex DNA annealing intermediate | |||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN/DNA / Single strand annealing protein / SSAP / annealase / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex | |||||||||||||||||||||||||||
| Function / homology | Function and homology informationmitochondrial chromosome / : / recombinational repair / mitochondrial nucleoid / interstrand cross-link repair / single-stranded DNA binding / DNA repair / mitochondrion / DNA binding Similarity search - Function | |||||||||||||||||||||||||||
| Biological species | ![]() Inovirus M13 | |||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.54 Å | |||||||||||||||||||||||||||
Authors | Wheat, C.T. / Bell, C.E. | |||||||||||||||||||||||||||
| Funding support | United States, 1items
| |||||||||||||||||||||||||||
Citation | Journal: bioRxiv / Year: 2025Title: Mechanism of single-strand annealing from native mass spectrometry and cryo-EM structures of RAD52 homolog Mgm101. Authors: Carter T Wheat / Zihao Qi / Miqdad Hussain / Katerina Zakharova / Vicki H Wysocki / Charles E Bell / ![]() Abstract: RAD52, the primary single-strand annealing (SSA) protein in humans, forms undecameric rings that bind ssDNA within a narrow, positively-charged groove. Whether RAD52 anneals two complementary ssDNAs ...RAD52, the primary single-strand annealing (SSA) protein in humans, forms undecameric rings that bind ssDNA within a narrow, positively-charged groove. Whether RAD52 anneals two complementary ssDNAs on the same ring in , or between two ring-ssDNA complexes in , is unknown. Here, we determined cryo-EM structures of Mgm101, a RAD52 homolog from yeast mitochondria, in complexes with ssDNA, a duplex intermediate of annealing, and B-form dsDNA product. In all states, Mgm101 forms a closed nonadecameric ring that binds the backbone of the first ssDNA at the base of the narrow groove. The second complementary strand binds directly on top of the first to form an extended, unwound, and circular duplex intermediate of annealing. The third complex captures apparent B-form DNA product bound to a novel β-hairpin motif located on top of the Mgm101 ring, above the primary DNA-binding groove. Mass photometry and native mass spectrometry confirm and further elucidate the complexes formed in solution. Altogether, our data reveal the full SSA pathway of Mgm101 and suggest it anneals two complementary ssDNAs on the same ring in . Structural conservation with RAD52 suggests it is likely to use a similar mechanism of annealing. | |||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9yi7.cif.gz | 747.8 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9yi7.ent.gz | 617.5 KB | Display | PDB format |
| PDBx/mmJSON format | 9yi7.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/yi/9yi7 ftp://data.pdbj.org/pub/pdb/validation_reports/yi/9yi7 | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 72980MC ![]() 9yi6C ![]() 9yi8C ![]() 9yi9C ![]() 9yiaC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
| Experimental dataset #1 | Data reference: 10.6019/EMPIAR-13025 / Data set type: EMPIAR / Metadata reference: 10.6019/EMPIAR-13025 |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
| #1: DNA chain | Mass: 13642.332 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: the actual sequence is: TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAA Source: (synth.) Inovirus M13 | ||
|---|---|---|---|
| #2: DNA chain | Mass: 13822.428 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: The actual sequence is: TTAAAACATGTTGAGCTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAA Source: (synth.) Inovirus M13 | ||
| #3: Protein | Mass: 28524.535 Da / Num. of mol.: 19 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: MGM101, MGM9, YJR144W, J2181 / Production host: ![]() Has protein modification | N | |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: Cryo-EM structure of yeast Mgm101 bound to duplex DNA annealing intermediate Type: COMPLEX / Entity ID: all / Source: RECOMBINANT |
|---|---|
| Molecular weight | Value: 0.587 MDa / Experimental value: YES |
| Source (natural) | Organism: ![]() |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: TFS KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm / Cs: 0.01 mm / C2 aperture diameter: 50 µm |
| Image recording | Average exposure time: 2.7 sec. / Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of grids imaged: 1 |
| EM imaging optics | Energyfilter name: GIF Bioquantum / Energyfilter slit width: 20 eV |
-
Processing
| EM software |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C19 (19 fold cyclic) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 2.54 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 40943 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refinement | Highest resolution: 2.54 Å Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS) | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi




Inovirus M13
United States, 1items
Citation








PDBj









































FIELD EMISSION GUN