[English] 日本語
Yorodumi- PDB-9waf: Cryo-EM structure of helicase DruE in the Druantia anti-phage sys... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9waf | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of helicase DruE in the Druantia anti-phage system elucidates its anti-phage mechanism | |||||||||
Components |
| |||||||||
Keywords | HYDROLASE/DNA / SF2 Helicase / DNA-dependent ATPase / DNA-binding / DNA BINDING PROTEIN / HYDROLASE-DNA complex | |||||||||
| Function / homology | Function and homology information3'-5' DNA helicase activity / interstrand cross-link repair / nucleotide-excision repair / nucleic acid binding / ATP binding Similarity search - Function | |||||||||
| Biological species | Pseudomonas protegens Pf-5 (bacteria)synthetic construct (others) | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.29 Å | |||||||||
Authors | Hou, J. / He, Y.X. / Gui, L. | |||||||||
| Funding support | China, 1items
| |||||||||
Citation | Journal: To Be PublishedTitle: Cryo-EM structure of helicase DruE in the Druantia anti-phage system elucidates its anti-phage mechanism Authors: Hou, J. / He, Y.X. / Gui, L. | |||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9waf.cif.gz | 773.7 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9waf.ent.gz | Display | PDB format | |
| PDBx/mmJSON format | 9waf.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/wa/9waf ftp://data.pdbj.org/pub/pdb/validation_reports/wa/9waf | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 65816MC ![]() 9waeC ![]() 9wdsC ![]() 9wduC ![]() 9wdwC ![]() 9wdyC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
| #1: Protein | Mass: 221376.172 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Pseudomonas protegens Pf-5 (bacteria) / Strain: ATCC BAA-477 / NRRL B-23932 / Pf-5 / Gene: PFL_3016Production host: ![]() References: UniProt: Q4KCB1 #2: DNA chain | | Mass: 21490.730 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: Nucleotides 16 to 44 (AGCACTGCTATTCCCTAGCAGTGCTCATC) were omitted from the atomic model because no corresponding density was observed in the cryo-EM reconstruction. Source: (synth.) synthetic construct (others) #3: Chemical | #4: Chemical | #5: Chemical | ChemComp-ZN / Has ligand of interest | Y | Has protein modification | N | |
|---|
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: DruE-DNA-ADP complex / Type: COMPLEX / Entity ID: #1-#2 / Source: RECOMBINANT | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: 0.463 MDa / Experimental value: NO | |||||||||||||||
| Source (natural) | Organism: Pseudomonas protegens Pf-5 (bacteria) | |||||||||||||||
| Source (recombinant) | Organism: ![]() Plasmid: pETDuet-1 | |||||||||||||||
| Buffer solution | pH: 8 / Details: 150mM NaCl,20mM Tris-HCL | |||||||||||||||
| Buffer component |
| |||||||||||||||
| Specimen | Conc.: 1.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | |||||||||||||||
| Specimen support | Grid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3 | |||||||||||||||
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: TFS KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 1600 nm / Nominal defocus min: 800 nm / Cs: 2.7 mm |
| Image recording | Electron dose: 50 e/Å2 / Film or detector model: TFS FALCON 4i (4k x 4k) |
-
Processing
| EM software |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.29 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 210656 / Symmetry type: POINT | ||||||||||||||||||||||||
| Atomic model building | Protocol: FLEXIBLE FIT / Space: REAL / Details: Initial local fitting was done using Chimerax | ||||||||||||||||||||||||
| Atomic model building | Source name: AlphaFold / Type: in silico model | ||||||||||||||||||||||||
| Refinement | Highest resolution: 3.29 Å Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS) | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Pseudomonas protegens Pf-5 (bacteria)
China, 1items
Citation


















PDBj











































FIELD EMISSION GUN