[English] 日本語
Yorodumi
- PDB-9waf: Cryo-EM structure of helicase DruE in the Druantia anti-phage sys... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9waf
TitleCryo-EM structure of helicase DruE in the Druantia anti-phage system elucidates its anti-phage mechanism
Components
  • Helicase
  • forked DNA
KeywordsHYDROLASE/DNA / SF2 Helicase / DNA-dependent ATPase / DNA-binding / DNA BINDING PROTEIN / HYDROLASE-DNA complex
Function / homology
Function and homology information


3'-5' DNA helicase activity / interstrand cross-link repair / nucleotide-excision repair / nucleic acid binding / ATP binding
Similarity search - Function
YjiV N-terminal domain / DEAD/DEAH box helicase domain / DEAD/DEAH box helicase / Helicase conserved C-terminal domain / helicase superfamily c-terminal domain / Superfamilies 1 and 2 helicase ATP-binding type-1 domain profile. / DEAD-like helicases superfamily / Helicase, C-terminal / Helicase superfamily 1/2, ATP-binding domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE-5'-DIPHOSPHATE / DNA / DNA (> 10) / Helicase
Similarity search - Component
Biological speciesPseudomonas protegens Pf-5 (bacteria)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.29 Å
AuthorsHou, J. / He, Y.X. / Gui, L.
Funding support China, 1items
OrganizationGrant numberCountry
National Natural Science Foundation of China (NSFC)31971422 China
CitationJournal: To Be Published
Title: Cryo-EM structure of helicase DruE in the Druantia anti-phage system elucidates its anti-phage mechanism
Authors: Hou, J. / He, Y.X. / Gui, L.
History
DepositionAug 12, 2025Deposition site: PDBJ / Processing site: PDBC
Revision 1.0Aug 26, 2026Provider: repository / Type: Initial release
Revision 1.0Aug 26, 2026Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Helicase
B: Helicase
C: forked DNA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)465,66915
Polymers464,2433
Non-polymers1,42612
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein Helicase


Mass: 221376.172 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Pseudomonas protegens Pf-5 (bacteria) / Strain: ATCC BAA-477 / NRRL B-23932 / Pf-5 / Gene: PFL_3016
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
References: UniProt: Q4KCB1
#2: DNA chain forked DNA


Mass: 21490.730 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Nucleotides 16 to 44 (AGCACTGCTATTCCCTAGCAGTGCTCATC) were omitted from the atomic model because no corresponding density was observed in the cryo-EM reconstruction.
Source: (synth.) synthetic construct (others)
#3: Chemical ChemComp-ADP / ADENOSINE-5'-DIPHOSPHATE


Mass: 427.201 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: C10H15N5O10P2 / Feature type: SUBJECT OF INVESTIGATION / Comment: ADP, energy-carrying molecule*YM
#4: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Mg / Feature type: SUBJECT OF INVESTIGATION
#5: Chemical
ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 8 / Source method: obtained synthetically / Formula: Zn / Feature type: SUBJECT OF INVESTIGATION
Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: DruE-DNA-ADP complex / Type: COMPLEX / Entity ID: #1-#2 / Source: RECOMBINANT
Molecular weightValue: 0.463 MDa / Experimental value: NO
Source (natural)Organism: Pseudomonas protegens Pf-5 (bacteria)
Source (recombinant)Organism: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
Plasmid: pETDuet-1
Buffer solutionpH: 8 / Details: 150mM NaCl,20mM Tris-HCL
Buffer component
IDConc.NameFormulaBuffer-ID
1150 mM/Lsodium chlorideNaCl1
220 mM/LTRIS hydrochlorideTris-Hcl1
SpecimenConc.: 1.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 1600 nm / Nominal defocus min: 800 nm / Cs: 2.7 mm
Image recordingElectron dose: 50 e/Å2 / Film or detector model: TFS FALCON 4i (4k x 4k)

-
Processing

EM software
IDNameVersionCategory
1cryoSPARCparticle selection
2EPUimage acquisition
9PHENIX1.21.2_5419model refinement
12cryoSPARCclassification
13cryoSPARC3D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.29 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 210656 / Symmetry type: POINT
Atomic model buildingProtocol: FLEXIBLE FIT / Space: REAL / Details: Initial local fitting was done using Chimerax
Atomic model buildingSource name: AlphaFold / Type: in silico model
RefinementHighest resolution: 3.29 Å
Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS)
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00331809
ELECTRON MICROSCOPYf_angle_d0.53443254
ELECTRON MICROSCOPYf_dihedral_angle_d9.8844688
ELECTRON MICROSCOPYf_chiral_restr0.0394715
ELECTRON MICROSCOPYf_plane_restr0.0045565

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more