[English] 日本語
Yorodumi
- PDB-9bwv: Structure of influenza D RNP, 4xNP local resconstruction -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9bwv
TitleStructure of influenza D RNP, 4xNP local resconstruction
Components
  • FluD-NS vRNA
  • Nucleoprotein
KeywordsVIRAL PROTEIN/RNA / Influenza / Ribonucleoprotein complex / nucleoprotein / VIRAL PROTEIN-RNA complex
Function / homology
Function and homology information


helical viral capsid / viral penetration into host nucleus / host cell / viral nucleocapsid / ribonucleoprotein complex / symbiont entry into host cell / structural molecule activity / RNA binding
Similarity search - Function
Influenza virus nucleoprotein (NP) / Influenza virus nucleoprotein
Similarity search - Domain/homology
RNA / RNA (> 10) / Nucleoprotein
Similarity search - Component
Biological speciesInfluenza D virus
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 5.1 Å
AuthorsPeng, R. / Chang, Y.-W.
Funding support United States, 1items
OrganizationGrant numberCountry
David and Lucile Packard Foundation2019-69645 United States
CitationJournal: Science / Year: 2025
Title: Molecular basis of influenza ribonucleoprotein complex assembly and processive RNA synthesis.
Authors: Ruchao Peng / Xin Xu / Binod Nepal / Yikang Gong / Fenglin Li / Max B Ferretti / Mingyang Zhou / Kristen W Lynch / George M Burslem / Sandhya Kortagere / Ronen Marmorstein / Yi-Wei Chang /
Abstract: Influenza viruses replicate and transcribe their genome in the context of a conserved ribonucleoprotein (RNP) complex. By integrating cryo-electron microscopy single-particle analysis and cryo- ...Influenza viruses replicate and transcribe their genome in the context of a conserved ribonucleoprotein (RNP) complex. By integrating cryo-electron microscopy single-particle analysis and cryo-electron tomography, we define the influenza RNP as a right-handed, antiparallel double helix with the viral RNA encapsidated in the minor groove. Individual nucleoprotein subunits are connected by a flexible tail loop that inserts into a conserved pocket in its neighbor. We visualize the viral polymerase in RNP at different functional states, revealing how it accesses the RNA template while maintaining the double-helical architecture of RNP by strand sliding. Targeting the tail loop binding interface, we identify lead compounds as potential anti-influenza inhibitors. These findings elucidate the molecular determinants underpinning influenza virus replication and highlight a promising target for antiviral development.
History
DepositionMay 22, 2024Deposition site: RCSB / Processing site: RCSB
Revision 1.0May 14, 2025Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: Additional map / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0May 14, 2025Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 2.0May 21, 2025Data content type: EM metadata / Data content type: EM metadata / Group: Experimental summary / Data content type: EM metadata / Category: em_admin / Data content type: EM metadata / Item: _em_admin.last_update
Revision 2.0May 21, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Data updated
Revision 1.1May 28, 2025Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.identifier_ORCID / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Nucleoprotein
C: Nucleoprotein
E: Nucleoprotein
H: Nucleoprotein
B: FluD-NS vRNA
D: FluD-NS vRNA
F: FluD-NS vRNA
G: FluD-NS vRNA


Theoretical massNumber of molelcules
Total (without water)269,6308
Polymers269,6308
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: homology, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein
Nucleoprotein


Mass: 61329.227 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Influenza D virus / Gene: NP / Production host: Homo sapiens (human) / References: UniProt: K9LG94
#2: RNA chain
FluD-NS vRNA


Mass: 6078.359 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Influenza D virus / Production host: Homo sapiens (human)
Has protein modificationN
Sequence detailsSample RNA sequence is ...Sample RNA sequence is AGCAGUAGCAAGGGGUUUUUUCAUACUAAAGAACGAAUACAUUCUUUUAACAUUGAAAUUGUUCUCGAAACUGACUUGAUUUCAUCCAAAGCGGCCCUCAUAUCCUGGUUAGUCAAAGAGUUCACCAUCGCUACUCCCAGCUUGGAUUUCAACCUUAUCAAUGACACCAAGCAACUCCUGAACCUCUCCAGUAGUUGCGCCUUCUCUUCUCCAGAAGGGAUCUGUUUCACAUCCAGAUUUGUAUCGUCUGAUUUCAUCUCUAGAUUCCGCAUCAACGGCAACAACAAGUCCACUUCUCCAAAUUCUGAGUAUCUUUCGUACUGACUUCUCUGGGUCAUCUCCUCUACGGAAAUUCUUAAGGCAGUAAGCUGGUUUCUCAGUGUUUCUGCAAAAGAGCACAAUGAUUUCUCCCAUGUCGGUCACUAAUAGUUCAGCAGUUUUUACAAAGCAAUUGCAGUUCCGAUAUUUUACUCCAAAGACUUCUCCUUGUCUUAUGAGCUUUGGCUCAUACAGAGUGUCAAUGGUACAUGGGCUUAGAUAGAAAGGGUUUCCUCCUAAGGGAUAGAUAAUGUUCUUCCCCAAUUCAACAGCAUGAGUCUCCUCUGGUUUUCUUAAGGCAGCAAUAGUAGUGAAUCCUAGAAUUUCUCUACCUUCAGCCACUGCAUCUUCCCAAGUUCUCGGUUCAUAAACCUGUUCGACUCUCAGUGAAUUCUCAGCAGACUUUCUCAUUUUCUCGAAAGUCAUUAACCCAGAGGAAUCCAUCCAGCUGGCUGCGCCCAAUGCCAAUUCGGAGAUUGCUGCUCUGAUAUUUGUUGUGUUCACUGACUUAUUUUCAGACAUAUUGAAAUUGUACACCCCUGCUUAUGCU

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: influenza D virus RNP complex / Type: COMPLEX / Entity ID: #2, #1 / Source: RECOMBINANT
Molecular weightValue: 2 MDa / Experimental value: NO
Source (natural)Organism: Influenza D virus
Source (recombinant)Organism: Homo sapiens (human)
Buffer solutionpH: 7.4 / Details: 1x PBS
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationInstrument: LEICA EM GP / Cryogen name: ETHANE-PROPANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 3500 nm / Nominal defocus min: 1300 nm / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 60 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k)

-
Processing

EM software
IDNameVersionCategoryDetails (eV)
1cryoSPARC4particle selection
2EPU2.13image acquisition
4CTFFIND4.1CTF correction
7UCSF ChimeraX1.5model fitting
9PHENIX1.19model refinement
10RELION3.1initial Euler assignment
11RELION5final Euler assignment
12RELION3.1classification
13RELION53D reconstructionDynaMight
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 2000000
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 5.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 237636 / Symmetry type: POINT
Atomic model buildingProtocol: FLEXIBLE FIT / Space: REAL / Target criteria: cross correlation coefficient
Atomic model buildingPDB-ID: 5N2U
Pdb chain-ID: A / Accession code: 5N2U / Source name: PDB / Type: experimental model

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more